Gene detail

Detail information of GWHGAAZE010097

Functional Annotation

Database	Orthologs	E value	Annotation
Nr	YP_008520169.1	9.3432E-154	cytochrome b6 (chloroplast) [Camellia taliensis]
Swissprot	tr\|Q1KXS9\|CYB6_HELAN	1E-153	Cytochrome b6 {ECO:0000255\|HAMAP-Rule:MF_00633}
trEMBL	tr\|T1WXL8\|T1WXL8_9ERIC	3E-154	Cytochrome b6 {ECO:0000256\|HAMAP-Rule:MF_00633}
TAIR10	ATCG00720.1	8E-119	photosynthetic electron transfer B

Location And Transcript Sequence (JBrowse)

Scaffold	Type	Start	End	Strand
GWHAAZE00000002	gene	123398028	123398690	+
GWHAAZE00000002	mRNA	123398028	123398690	+
GWHAAZE00000002	exon	123398028	123398690	+
GWHAAZE00000002	CDS	123398028	123398690	+

Transcript Sequence
>GWHTAAZE010109 GGGAGTCCCGCCTATCTCAATAAAGTTTATGATTGGTTTGAAGAACGTCTCGAGATTCAGGCGATTGCGGATGATATAACTAGTAAATATGTTCCTCCCCATGTCAACATATTTTATTGTCTAGGAGGAATTACGCTTACTTGTTTTTTGGTACAAGTGGCTACGGGGTTTGCTATGACTTTTGACTATCGTCCGACCGTTACTGACGCTTTTGCTTCTGTTCAATACATAATGACTGAAGCTAATTTTGGTTGGTTAATCCGATCTGTTCATCGATGGTCGGCAAGTATGATGGTTCTAATGATGATCTTACACGTATTTCGCGTGTATCTCACCGGTGGATTTAAAAAACCTCGAGAATTGACTTGGGTTACTGGGGTGGTTCTGGCTGTATTGACCGCATCTTTTGGCGTAACCGGTTATTCCTTACCTTGGGACCAAATTGGTTATTGGGCAGTGAAAATTGTAACAGGTGTCCCTGAAGCTATTCCTGTAATAGGACCTCCTTTGGTAGAATTATTGCGCGGGAGTGCTAGTGTGGGACAATCCACTTTGACTCGGTTTTATAGTTTACACACTTTTGTATTACCACTTCTTACTGCGGTATTTATGTTAATGCACTTTCCGATGATACGTAAACAAGGCATTTCTGGTCCTTTATAG

Network for GWHGAAZE010097

Network category	Network	Top300 PCC genelist
Coexpression Positive	Network	Top300 PCC genelist
Coexpression Negative	Network	Top300 PCC genelist

Functional Module

Module ID	Function Annotation

Protein Structure

Pfam accession	Pfam name	Alignment start	Alignment end	E-value
PF00033.20	Cytochrome_B	27	215	3.50E-85

Protein Sequence

Gene family

Gene family	subfamily
--	--

KEGG pathway

KO	Enzyme	pathway	mapID
K02635	petB	Metabolic pathways	map01100
K02635	petB	Photosynthesis	map00195

Gene Ontology

GO term	Ontology	Name
GO:0022904	biological_process	respiratory electron transport chain
GO:0016020	cellular_component	membrane
GO:0009055	molecular_function	electron transfer activity
GO:0016491	molecular_function	oxidoreductase activity

Expression pattern

Expression pattern detail

SRP	Sample	Description	TPM
SRP075780	SRR3591705	youngest leaf	0.353
	SRR3591706	second leaf	2.487
	SRR3591707	mature leaf	2.495
	SRR3591708	Shoot apex	2.299
	SRR3591709	Stem	0.462
	SRR3591710	White floral bud	0.309
	SRR3591711	White flower	0.257
	SRR3591712	Green floral bud	0.443
	SRR3591713	Yellow flower	0.265
SRP173429	SRR8316895	Juvenile bud stage	12.765
	SRR8316896	Juvenile bud stage	4.868
	SRR8316897	Juvenile bud stage	19.774
	SRR8316894	Third green stage	17.678
	SRR8316900	Third green stage	1.444
	SRR8316901	Third green stage	1.608
	SRR8316898	Complete white stage	7.019
	SRR8316899	Complete white stage	0.113
	SRR8316903	Complete white stage	4.821
	SRR8316902	Silver flowering stage	8.740
	SRR8316904	Silver flowering stage	8.360
	SRR8316905	Silver flowering stage	6.752
	SRR8316906	Gold flowering stage	0.654
	SRR8316907	Gold flowering stage	0.100
	SRR8316908	Gold flowering stage	0.526
SRP132670	SRR6706286	Control	0.277
	SRR6706287	Light intensity 50%	0.365
	SRR6706288	Light intensity 20%	0.399
CNP0000432	CNS0095592	Slightly white alabastrum(diploid) 1	5.765
	CNS0095593	Slightly white alabastrum(diploid) 2	3.590
	CNS0095594	Slightly white alabastrum(diploid) 3	4.806
	CNS0095595	Whole white alabastrum(diploid) 2	7.586
	CNS0095596	Whole white alabastrum(diploid) 3	4.648
	CNS0095597	Whole white alabastrum(diploid) 4	4.351
	CNS0095598	Silvery flower (diploied) 1	3.469
	CNS0095599	Silvery flower (diploied) 2	2.764
	CNS0095600	Silvery flower (diploied) 3	1.278
	CNS0095601	Golden flower (diploid) 1	3.374
	CNS0095602	Golden flower (diploid) 2	1.241
	CNS0095603	Golden flower (diploid) 3	1.448
	CNS0095604	Slightly white alabastrum(tetraploid) 1	8.157
	CNS0095605	Slightly white alabastrum(tetraploid) 2	7.626
	CNS0095606	Slightly white alabastrum(tetraploid) 3	2.333
	CNS0095607	Whole white alabastrum(tetraploid) 1	4.345
	CNS0095608	Whole white alabastrum(tetraploid) 2	6.677
	CNS0095609	Whole white alabastrum(tetraploid) 3	2.051
	CNS0095610	Silvery flower (diploied) 1	1.446
	CNS0095611	Silvery flower (diploied) 2	1.379
	CNS0095612	Silvery flower (diploied) 3	1.666
	CNS0095613	Golden flower (tetraploid) 1	6.187
	CNS0095614	Golden flower (tetraploid) 2	2.588
	CNS0095615	Golden flower (tetraploid) 3	1.137
CRA001975	CRR073297	Stem 1	3.101
	CRR073298	Stem 2	5.514
	CRR073299	Stem 3	1.348
	CRR073300	Leaf 1	1.639
	CRR073301	Leaf 2	1.663
	CRR073302	Leaf 3	1.237
	CRR073303	Juvenile bud 1	1.708
	CRR073304	Juvenile bud 2	1.389
	CRR073305	Juvenile bud 3	4.540
	CRR073306	Third green 1	1.522
	CRR073307	Third green 2	0.954
	CRR073308	Third green 3	2.513
	CRR073309	Second white 1	1.992
	CRR073310	Second white 2	3.712
	CRR073311	Second white 3	9.054
	CRR073312	Silver flowering 1	6.376
	CRR073313	Silver flowering 2	1.220
	CRR073314	Silver flowering 3	3.810
	CRR073315	Gold flowering 1	30.020
	CRR073316	Gold flowering 2	23.897
	CRR073317	Gold flowering 3	41.820
	CRR073318	Tawny withering 1	2.523
	CRR073319	Tawny withering 2	1.460
	CRR073320	Tawny withering 3	1.269