Gene detail

Detail information of GWHGAAZE010176

Functional Annotation

Database	Orthologs	E value	Annotation
Nr	YP_008520169.1	5.2625E-155	cytochrome b6 (chloroplast) [Camellia taliensis]
Swissprot	tr\|Q1KXS9\|CYB6_HELAN	4E-155	Cytochrome b6 {ECO:0000255\|HAMAP-Rule:MF_00633}
trEMBL	tr\|T1WXL8\|T1WXL8_9ERIC	2E-155	Cytochrome b6 {ECO:0000256\|HAMAP-Rule:MF_00633}
TAIR10	ATCG00720.1	8E-120	photosynthetic electron transfer B

Location And Transcript Sequence (JBrowse)

Scaffold	Type	Start	End	Strand
GWHAAZE00000002	gene	123898814	123899476	-
GWHAAZE00000002	mRNA	123898814	123899476	-
GWHAAZE00000002	exon	123898814	123899476	-
GWHAAZE00000002	CDS	123898814	123899476	-

Transcript Sequence
>GWHTAAZE010188 GGGAGTCCCGCCTATCTCAATAAAGTTTATGATTGGTTTGAAGAACGTCTCGAGATTCAGGCAATTGCGGATGATATAACTAGTAAATATGTTCCTCCCCATGTCAACATATTTTATTGTCTAGGAGGAATTACGCTTACTTGTTTTTTGGTACAAGTGGCTACGGGGTTTGCTATGACTTTTTACTATCGTCCGACCGTTACTGACGCTTTTGCTTCTGTTCAATACATAATGACTGAAGCTAATTTTGGTTGGTTAATCCGATCTGTTCATCGATGGTCGGCAAGTATGATGGTTCTAATGATGATCTTACACGTATTTCGCGTGTATCTCACCGGTGGATTTAAAAAACCTCGAGAATTGACTTGGGTTACTGGGGTGGTTCTGGCTGTATTGACCGCATCTTTTGGCGTAACCGGTTATTCCTTACCTTGGGACCAAATTGGTTATTGGGCAGTGAAAATTGTAACAGGTGTCCCTGAAGCTATTCCTGTAATAGGACCTCCTTTGGTAGAATTATTGCGCGGGAGTGCTAGTGTGGGACAATCCACTTTGACTCGGTTTTATAGTTTACACACTTTTGTATTACCACTTCTTACTGCGGTATTTATGTTAATGCACTTTCCGATGATACGTAAACAAGGCATTTCTGGTCCTTTATAG

Network for GWHGAAZE010176

Network category	Network	Top300 PCC genelist
Coexpression Positive	Network	Top300 PCC genelist
Coexpression Negative	Network	Top300 PCC genelist

Functional Module

Module ID	Function Annotation

Protein Structure

Pfam accession	Pfam name	Alignment start	Alignment end	E-value
PF00033.20	Cytochrome_B	27	215	5.80E-86

Protein Sequence

Gene family

Gene family	subfamily
--	--

KEGG pathway

KO	Enzyme	pathway	mapID
K02635	petB	Metabolic pathways	map01100
K02635	petB	Photosynthesis	map00195

Gene Ontology

GO term	Ontology	Name
GO:0022904	biological_process	respiratory electron transport chain
GO:0016020	cellular_component	membrane
GO:0009055	molecular_function	electron transfer activity
GO:0016491	molecular_function	oxidoreductase activity

Expression pattern

Expression pattern detail

SRP	Sample	Description	TPM
SRP075780	SRR3591705	youngest leaf	0.289
	SRR3591706	second leaf	2.509
	SRR3591707	mature leaf	2.479
	SRR3591708	Shoot apex	2.487
	SRR3591709	Stem	0.355
	SRR3591710	White floral bud	0.438
	SRR3591711	White flower	0.166
	SRR3591712	Green floral bud	0.597
	SRR3591713	Yellow flower	0.182
SRP173429	SRR8316895	Juvenile bud stage	15.985
	SRR8316896	Juvenile bud stage	6.176
	SRR8316897	Juvenile bud stage	26.104
	SRR8316894	Third green stage	22.953
	SRR8316900	Third green stage	1.928
	SRR8316901	Third green stage	1.532
	SRR8316898	Complete white stage	9.730
	SRR8316899	Complete white stage	0.459
	SRR8316903	Complete white stage	6.624
	SRR8316902	Silver flowering stage	11.235
	SRR8316904	Silver flowering stage	10.814
	SRR8316905	Silver flowering stage	8.697
	SRR8316906	Gold flowering stage	0.365
	SRR8316907	Gold flowering stage	0.150
	SRR8316908	Gold flowering stage	0.656
SRP132670	SRR6706286	Control	0.268
	SRR6706287	Light intensity 50%	0.347
	SRR6706288	Light intensity 20%	0.259
CNP0000432	CNS0095592	Slightly white alabastrum(diploid) 1	9.339
	CNS0095593	Slightly white alabastrum(diploid) 2	5.363
	CNS0095594	Slightly white alabastrum(diploid) 3	8.258
	CNS0095595	Whole white alabastrum(diploid) 2	9.966
	CNS0095596	Whole white alabastrum(diploid) 3	8.357
	CNS0095597	Whole white alabastrum(diploid) 4	8.341
	CNS0095598	Silvery flower (diploied) 1	4.859
	CNS0095599	Silvery flower (diploied) 2	5.100
	CNS0095600	Silvery flower (diploied) 3	1.652
	CNS0095601	Golden flower (diploid) 1	4.245
	CNS0095602	Golden flower (diploid) 2	1.231
	CNS0095603	Golden flower (diploid) 3	2.202
	CNS0095604	Slightly white alabastrum(tetraploid) 1	10.437
	CNS0095605	Slightly white alabastrum(tetraploid) 2	11.451
	CNS0095606	Slightly white alabastrum(tetraploid) 3	3.653
	CNS0095607	Whole white alabastrum(tetraploid) 1	6.783
	CNS0095608	Whole white alabastrum(tetraploid) 2	12.545
	CNS0095609	Whole white alabastrum(tetraploid) 3	3.810
	CNS0095610	Silvery flower (diploied) 1	2.193
	CNS0095611	Silvery flower (diploied) 2	2.881
	CNS0095612	Silvery flower (diploied) 3	2.901
	CNS0095613	Golden flower (tetraploid) 1	9.699
	CNS0095614	Golden flower (tetraploid) 2	3.736
	CNS0095615	Golden flower (tetraploid) 3	1.993
CRA001975	CRR073297	Stem 1	6.747
	CRR073298	Stem 2	8.583
	CRR073299	Stem 3	2.718
	CRR073300	Leaf 1	2.494
	CRR073301	Leaf 2	3.358
	CRR073302	Leaf 3	3.174
	CRR073303	Juvenile bud 1	3.496
	CRR073304	Juvenile bud 2	2.990
	CRR073305	Juvenile bud 3	8.547
	CRR073306	Third green 1	4.041
	CRR073307	Third green 2	1.417
	CRR073308	Third green 3	4.383
	CRR073309	Second white 1	2.436
	CRR073310	Second white 2	5.873
	CRR073311	Second white 3	13.625
	CRR073312	Silver flowering 1	8.617
	CRR073313	Silver flowering 2	5.653
	CRR073314	Silver flowering 3	7.118
	CRR073315	Gold flowering 1	49.405
	CRR073316	Gold flowering 2	33.619
	CRR073317	Gold flowering 3	75.276
	CRR073318	Tawny withering 1	3.882
	CRR073319	Tawny withering 2	1.668
	CRR073320	Tawny withering 3	2.684