Gene detail

Detail information of GWHGAAZE010178

Functional Annotation

Database	Orthologs	E value	Annotation
Nr	ADD31105.1	2.78773E-95	clp protease proteolytic subunit protein (chloroplast) [Lonicera japonica]
Swissprot	tr\|Q0G9J4\|CLPP_LIRTU	4E-39	ATP-dependent Clp protease proteolytic subunit {ECO:0000255\|HAMAP-Rule:MF_00444}
trEMBL	tr\|D3WBN4\|D3WBN4_LONJA	1E-95	ATP-dependent Clp protease proteolytic subunit {ECO:0000256\|RuleBase:RU003567}
TAIR10	ATCG00670.1	4E-24	plastid-encoded CLP P

Location And Transcript Sequence (JBrowse)

Scaffold	Type	Start	End	Strand
GWHAAZE00000002	gene	123903376	123903801	+
GWHAAZE00000002	mRNA	123903376	123903801	+
GWHAAZE00000002	exon	123903376	123903801	+
GWHAAZE00000002	CDS	123903376	123903801	+

Transcript Sequence
>GWHTAAZE010190 ATGGATTCGCTATTTTTTGATATGCTGGTATATTTGCCACCAACGATGCATACATTGAGTATCGGAGAATGCGCCTCAATGGCATCTTTGATCGTGGCCGGAGGAACATTTACCCAACGTATAGCATTCCCTCACAGTAGGATAATGATCCATCAACCTAATACTTTTCCTTTTGAGACACCAACGGGAGAAACTTTCCTCGAAATAAAGGAATTCTGTCGCCTGCGTGCGTTGGTCGGAGAGGCTTATGCAAAAATAACGGGCCAACCCCTTTGGGTTGTAGAGATAGACCTGGAAAGAGATATTTTTATGTCAGCACAAGAAGCCAAAGATTATGGAATTGTTGATCTTGTAGCGAGTGGCAAGCTTGAATTTCGTCAAAACCCGAGTGTGCGCAAGCGGCCATTTGAGATTTTCCCTTCTTAA

Network for GWHGAAZE010178

Network category	Network	Top300 PCC genelist
Coexpression Positive	Network	Top300 PCC genelist
Coexpression Negative	Network	Top300 PCC genelist

Functional Module

Module ID	Function Annotation

Protein Structure

Pfam accession	Pfam name	Alignment start	Alignment end	E-value
PF00574.24	CLP_protease	6	119	6.20E-30

Protein Sequence

Gene family

Gene family	subfamily
--	--

KEGG pathway

KO	Enzyme	pathway	mapID
K01358	clpP, CLPP	Cell cycle - Caulobacter	map04112
K01358	clpP, CLPP	Longevity regulating pathway - worm	map04212

Gene Ontology

GO term	Ontology	Name
GO:0006508	biological_process	proteolysis
GO:0004252	molecular_function	serine-type endopeptidase activity

Expression pattern

Expression pattern detail

SRP	Sample	Description	TPM
SRP075780	SRR3591705	youngest leaf	0.221
	SRR3591706	second leaf	0.552
	SRR3591707	mature leaf	1.309
	SRR3591708	Shoot apex	0.811
	SRR3591709	Stem	0.160
	SRR3591710	White floral bud	1.176
	SRR3591711	White flower	0.354
	SRR3591712	Green floral bud	0.345
	SRR3591713	Yellow flower	0.297
SRP173429	SRR8316895	Juvenile bud stage	5.127
	SRR8316896	Juvenile bud stage	2.592
	SRR8316897	Juvenile bud stage	7.561
	SRR8316894	Third green stage	7.149
	SRR8316900	Third green stage	1.251
	SRR8316901	Third green stage	0.793
	SRR8316898	Complete white stage	2.791
	SRR8316899	Complete white stage	0.313
	SRR8316903	Complete white stage	1.750
	SRR8316902	Silver flowering stage	4.070
	SRR8316904	Silver flowering stage	2.187
	SRR8316905	Silver flowering stage	3.381
	SRR8316906	Gold flowering stage	1.302
	SRR8316907	Gold flowering stage	0.870
	SRR8316908	Gold flowering stage	1.348
SRP132670	SRR6706286	Control	0.494
	SRR6706287	Light intensity 50%	0.584
	SRR6706288	Light intensity 20%	0.489
CNP0000432	CNS0095592	Slightly white alabastrum(diploid) 1	1.941
	CNS0095593	Slightly white alabastrum(diploid) 2	2.507
	CNS0095594	Slightly white alabastrum(diploid) 3	2.063
	CNS0095595	Whole white alabastrum(diploid) 2	3.649
	CNS0095596	Whole white alabastrum(diploid) 3	2.458
	CNS0095597	Whole white alabastrum(diploid) 4	2.740
	CNS0095598	Silvery flower (diploied) 1	2.652
	CNS0095599	Silvery flower (diploied) 2	2.933
	CNS0095600	Silvery flower (diploied) 3	1.294
	CNS0095601	Golden flower (diploid) 1	2.090
	CNS0095602	Golden flower (diploid) 2	1.319
	CNS0095603	Golden flower (diploid) 3	1.303
	CNS0095604	Slightly white alabastrum(tetraploid) 1	2.599
	CNS0095605	Slightly white alabastrum(tetraploid) 2	2.500
	CNS0095606	Slightly white alabastrum(tetraploid) 3	0.839
	CNS0095607	Whole white alabastrum(tetraploid) 1	2.239
	CNS0095608	Whole white alabastrum(tetraploid) 2	3.899
	CNS0095609	Whole white alabastrum(tetraploid) 3	0.741
	CNS0095610	Silvery flower (diploied) 1	1.403
	CNS0095611	Silvery flower (diploied) 2	0.752
	CNS0095612	Silvery flower (diploied) 3	1.074
	CNS0095613	Golden flower (tetraploid) 1	2.110
	CNS0095614	Golden flower (tetraploid) 2	0.839
	CNS0095615	Golden flower (tetraploid) 3	1.253
CRA001975	CRR073297	Stem 1	4.931
	CRR073298	Stem 2	6.342
	CRR073299	Stem 3	2.186
	CRR073300	Leaf 1	3.669
	CRR073301	Leaf 2	3.262
	CRR073302	Leaf 3	1.723
	CRR073303	Juvenile bud 1	4.988
	CRR073304	Juvenile bud 2	3.301
	CRR073305	Juvenile bud 3	6.668
	CRR073306	Third green 1	4.035
	CRR073307	Third green 2	2.715
	CRR073308	Third green 3	4.788
	CRR073309	Second white 1	3.101
	CRR073310	Second white 2	13.263
	CRR073311	Second white 3	21.601
	CRR073312	Silver flowering 1	20.905
	CRR073313	Silver flowering 2	6.371
	CRR073314	Silver flowering 3	8.308
	CRR073315	Gold flowering 1	19.478
	CRR073316	Gold flowering 2	15.079
	CRR073317	Gold flowering 3	13.795
	CRR073318	Tawny withering 1	3.778
	CRR073319	Tawny withering 2	2.675
	CRR073320	Tawny withering 3	2.248