Gene detail

Detail information of GWHGAAZE010202

Functional Annotation

Database	Orthologs	E value	Annotation
Nr	XP_010100011.1	3.2999E-107	ATP synthase subunit b [Morus notabilis]
Swissprot	tr\|Q49L12\|ATPF_EUCGG	2E-77	ATP synthase subunit b, chloroplastic {ECO:0000255\|HAMAP-Rule:MF_01398}
trEMBL	tr\|W9RM45\|W9RM45_9ROSA	1E-107	ATP synthase subunit b {ECO:0000313\|EMBL:EXB81182.1}
TAIR10	ATCG00130.1	2E-54	ATPase, F0 complex, subunit B/B', bacterial/chloroplast

Location And Transcript Sequence (JBrowse)

Scaffold	Type	Start	End	Strand
GWHAAZE00000002	gene	124016790	124018700	-
GWHAAZE00000002	mRNA	124016790	124018700	-
GWHAAZE00000002	exon	124016790	124017184	-
GWHAAZE00000002	exon	124018550	124018700	-
GWHAAZE00000002	CDS	124018550	124018700	-
GWHAAZE00000002	CDS	124016790	124017184	-

Transcript Sequence
>GWHTAAZE010214 ATGAATCCACTGATTTCTGCCGCTTCCGTTATTGCTGCTGGATTGGCTGTAGGGCTTGCTTCTATTGGACCTGGAGTTGGTCAAGGAACTGCTGCGGGCCAAGCTGTAGAAGGTATCGCGAGACAGCCCGAGGCAGAGGGAAAAATACGAGATAATCGAAAACAGAGGATTCTGAATGCTATTCGAAATTCAGAAGAACTGCGTGGGGGGGCCATTGAACGGCTAGAAAAAGCCCGGGCTCACTTACGGAAAGTGGAAATGGAAGCAGATCAGTATCGAGTGAATGGATACTCTGAGATAGAACGAGAAAGGTTGATTTTGATTAATTCAACTTATAAGACTTTGGAACAACTAGAAAATGACAACAACGAAACTATTCATTTTGAACAACAAAGGGCAATTAATCAAGTCCGACAACGGGTTTTCCAACAAGCCTTACAAGGAGCTCTAGGAACTTTGAATAGTTGTTTGAACAACGAGTTGCATTTACGTATCATCAGTGCCAATATTGACATATTGGGGGCGATGAACGAAATAACCGATTAG

Network for GWHGAAZE010202

Network category	Network	Top300 PCC genelist
Coexpression Positive	Network	Top300 PCC genelist
Coexpression Negative	Network	Top300 PCC genelist

Functional Module

Module ID	Function Annotation

Protein Structure

Pfam accession	Pfam name	Alignment start	Alignment end	E-value
PF00137.22	ATP-synt_C	11	48	6.20E-10
PF00430.19	ATP-synt_B	48	153	2.90E-19

Protein Sequence

Gene family

Gene family	subfamily
--	--

KEGG pathway

KO	Enzyme	pathway	mapID
K02109	ATPF0B, atpF	Metabolic pathways	map01100
		Oxidative phosphorylation	map00190
		Photosynthesis	map00195

Gene Ontology

GO term	Ontology	Name
GO:1902600	biological_process	proton transmembrane transport
GO:0015986	biological_process	ATP synthesis coupled proton transport
GO:0033177	cellular_component	proton-transporting two-sector ATPase complex, proton-transporting domain
GO:0045263	cellular_component	proton-transporting ATP synthase complex, coupling factor F(o)
GO:0015078	molecular_function	proton transmembrane transporter activity

Expression pattern

Expression pattern detail

SRP	Sample	Description	TPM
SRP075780	SRR3591705	youngest leaf	3.211
	SRR3591706	second leaf	14.926
	SRR3591707	mature leaf	15.850
	SRR3591708	Shoot apex	7.619
	SRR3591709	Stem	2.680
	SRR3591710	White floral bud	1.168
	SRR3591711	White flower	0.930
	SRR3591712	Green floral bud	1.596
	SRR3591713	Yellow flower	1.053
SRP173429	SRR8316895	Juvenile bud stage	24.547
	SRR8316896	Juvenile bud stage	10.303
	SRR8316897	Juvenile bud stage	36.673
	SRR8316894	Third green stage	35.683
	SRR8316900	Third green stage	6.163
	SRR8316901	Third green stage	4.233
	SRR8316898	Complete white stage	12.354
	SRR8316899	Complete white stage	2.260
	SRR8316903	Complete white stage	9.805
	SRR8316902	Silver flowering stage	16.409
	SRR8316904	Silver flowering stage	16.599
	SRR8316905	Silver flowering stage	16.236
	SRR8316906	Gold flowering stage	3.338
	SRR8316907	Gold flowering stage	1.672
	SRR8316908	Gold flowering stage	2.678
SRP132670	SRR6706286	Control	0.973
	SRR6706287	Light intensity 50%	1.562
	SRR6706288	Light intensity 20%	1.612
CNP0000432	CNS0095592	Slightly white alabastrum(diploid) 1	19.770
	CNS0095593	Slightly white alabastrum(diploid) 2	11.560
	CNS0095594	Slightly white alabastrum(diploid) 3	16.225
	CNS0095595	Whole white alabastrum(diploid) 2	17.492
	CNS0095596	Whole white alabastrum(diploid) 3	12.241
	CNS0095597	Whole white alabastrum(diploid) 4	15.686
	CNS0095598	Silvery flower (diploied) 1	11.162
	CNS0095599	Silvery flower (diploied) 2	10.100
	CNS0095600	Silvery flower (diploied) 3	6.139
	CNS0095601	Golden flower (diploid) 1	13.823
	CNS0095602	Golden flower (diploid) 2	4.942
	CNS0095603	Golden flower (diploid) 3	4.725
	CNS0095604	Slightly white alabastrum(tetraploid) 1	17.425
	CNS0095605	Slightly white alabastrum(tetraploid) 2	18.694
	CNS0095606	Slightly white alabastrum(tetraploid) 3	9.946
	CNS0095607	Whole white alabastrum(tetraploid) 1	13.144
	CNS0095608	Whole white alabastrum(tetraploid) 2	13.061
	CNS0095609	Whole white alabastrum(tetraploid) 3	9.702
	CNS0095610	Silvery flower (diploied) 1	4.436
	CNS0095611	Silvery flower (diploied) 2	6.900
	CNS0095612	Silvery flower (diploied) 3	4.247
	CNS0095613	Golden flower (tetraploid) 1	5.786
	CNS0095614	Golden flower (tetraploid) 2	5.286
	CNS0095615	Golden flower (tetraploid) 3	5.677
CRA001975	CRR073297	Stem 1	18.221
	CRR073298	Stem 2	15.719
	CRR073299	Stem 3	6.916
	CRR073300	Leaf 1	6.386
	CRR073301	Leaf 2	6.764
	CRR073302	Leaf 3	4.121
	CRR073303	Juvenile bud 1	7.175
	CRR073304	Juvenile bud 2	5.703
	CRR073305	Juvenile bud 3	13.732
	CRR073306	Third green 1	7.725
	CRR073307	Third green 2	4.556
	CRR073308	Third green 3	9.159
	CRR073309	Second white 1	6.683
	CRR073310	Second white 2	31.296
	CRR073311	Second white 3	37.043
	CRR073312	Silver flowering 1	24.652
	CRR073313	Silver flowering 2	4.264
	CRR073314	Silver flowering 3	11.158
	CRR073315	Gold flowering 1	40.087
	CRR073316	Gold flowering 2	43.443
	CRR073317	Gold flowering 3	31.732
	CRR073318	Tawny withering 1	6.269
	CRR073319	Tawny withering 2	6.089
	CRR073320	Tawny withering 3	8.054