Gene detail

Detail information of GWHGAAZE010537

Functional Annotation

Database	Orthologs	E value	Annotation
Nr	XP_010097720.1	4.23199E-42	3-hydroxyisobutyryl-CoA hydrolase 1 [Morus notabilis]
Swissprot	tr\|Q9LKJ1\|HIBC1_ARATH	9E-42	3-hydroxyisobutyryl-CoA hydrolase 1
trEMBL	tr\|W9RDH3\|W9RDH3_9ROSA	2E-42	3-hydroxyisobutyryl-CoA hydrolase 1 {ECO:0000313\|EMBL:EXB70675.1}
TAIR10	AT5G65940.2	8E-36	beta-hydroxyisobutyryl-CoA hydrolase 1

Location And Transcript Sequence (JBrowse)

Scaffold	Type	Start	End	Strand
GWHAAZE00000003	gene	13099664	13100906	-
GWHAAZE00000003	mRNA	13099664	13100906	-
GWHAAZE00000003	exon	13099664	13099777	-
GWHAAZE00000003	exon	13100552	13100650	-
GWHAAZE00000003	exon	13100841	13100906	-
GWHAAZE00000003	CDS	13100841	13100906	-
GWHAAZE00000003	CDS	13100552	13100650	-
GWHAAZE00000003	CDS	13099664	13099777	-

Transcript Sequence
>GWHTAAZE010549 ATTATTGTGGATATTATTGATAGGTGTTTCTCTCGAAGAACGGTTGAAGATATTTTATCTGCCTTAGAAATCGAGGCCAAAAACAGCAAGGATGATTGGATCTCTACAACCCTACAATCATTGAAGAAAGCATCCCCTATGAGTCTTAAAATTTCTCTTAGATTGATTAGAGAAGGGAGACTCCAAGGTGTTGGCCAATGCCTTGTGCGAGAGTACATAATGGTTTGTCATTTCATGAGAGGAGAAGTCAGCAAGGATTTCATTGAGGTGCCAACCTAA

Network for GWHGAAZE010537

Network category	Network	Top300 PCC genelist
Coexpression Positive	Network	Top300 PCC genelist
Coexpression Negative	Network	Top300 PCC genelist

Functional Module

Module ID	Function Annotation
CFinderModule0067	map00280 Valine, leucine and isoleucine degradation map00640 Propanoate metabolism map00410 beta-Alanine metabolism GO:0003860 3-hydroxyisobutyryl-CoA hydrolase activity GOslim:molecular_function map01200 Carbon metabolism map01100 Metabolic pathways
CFinderModule0068	GO:0006413 translational initiation GOslim:biological_process GO:0003743 translation initiation factor activity GOslim:molecular_function GO:0003860 3-hydroxyisobutyryl-CoA hydrolase activity GOslim:molecular_function map00410 beta-Alanine metabolism map00280 Valine, leucine and isoleucine degradation map00640 Propanoate metabolism

Protein Structure

Pfam accession	Pfam name	Alignment start	Alignment end	E-value
PF16113.6	ECH_2	4	89	4.20E-19

Protein Sequence

Gene family

Gene family	subfamily
--	--

KEGG pathway

KO	Enzyme	pathway	mapID
K05605	HIBCH	Metabolic pathways	map01100
		Carbon metabolism	map01200
		Propanoate metabolism	map00640
		Valine, leucine and isoleucine degradation	map00280
		beta-Alanine metabolism	map00410

Gene Ontology

GO term	Ontology	Name
GO:0003860	molecular_function	3-hydroxyisobutyryl-CoA hydrolase activity

Expression pattern

Expression pattern detail

SRP	Sample	Description	TPM
SRP075780	SRR3591705	youngest leaf	0.000
	SRR3591706	second leaf	0.000
	SRR3591707	mature leaf	0.106
	SRR3591708	Shoot apex	0.000
	SRR3591709	Stem	0.000
	SRR3591710	White floral bud	0.000
	SRR3591711	White flower	0.000
	SRR3591712	Green floral bud	0.000
	SRR3591713	Yellow flower	0.000
SRP173429	SRR8316895	Juvenile bud stage	5.953
	SRR8316896	Juvenile bud stage	11.629
	SRR8316897	Juvenile bud stage	0.502
	SRR8316894	Third green stage	4.116
	SRR8316900	Third green stage	7.839
	SRR8316901	Third green stage	10.598
	SRR8316898	Complete white stage	1.921
	SRR8316899	Complete white stage	9.490
	SRR8316903	Complete white stage	12.008
	SRR8316902	Silver flowering stage	5.042
	SRR8316904	Silver flowering stage	8.966
	SRR8316905	Silver flowering stage	3.406
	SRR8316906	Gold flowering stage	10.871
	SRR8316907	Gold flowering stage	5.719
	SRR8316908	Gold flowering stage	3.136
SRP132670	SRR6706286	Control	1.614
	SRR6706287	Light intensity 50%	1.637
	SRR6706288	Light intensity 20%	1.844
CNP0000432	CNS0095592	Slightly white alabastrum(diploid) 1	12.565
	CNS0095593	Slightly white alabastrum(diploid) 2	8.105
	CNS0095594	Slightly white alabastrum(diploid) 3	12.785
	CNS0095595	Whole white alabastrum(diploid) 2	6.972
	CNS0095596	Whole white alabastrum(diploid) 3	4.935
	CNS0095597	Whole white alabastrum(diploid) 4	5.909
	CNS0095598	Silvery flower (diploied) 1	14.080
	CNS0095599	Silvery flower (diploied) 2	9.861
	CNS0095600	Silvery flower (diploied) 3	6.814
	CNS0095601	Golden flower (diploid) 1	15.873
	CNS0095602	Golden flower (diploid) 2	5.940
	CNS0095603	Golden flower (diploid) 3	7.762
	CNS0095604	Slightly white alabastrum(tetraploid) 1	0.726
	CNS0095605	Slightly white alabastrum(tetraploid) 2	1.011
	CNS0095606	Slightly white alabastrum(tetraploid) 3	0.400
	CNS0095607	Whole white alabastrum(tetraploid) 1	0.823
	CNS0095608	Whole white alabastrum(tetraploid) 2	0.000
	CNS0095609	Whole white alabastrum(tetraploid) 3	0.106
	CNS0095610	Silvery flower (diploied) 1	0.169
	CNS0095611	Silvery flower (diploied) 2	0.371
	CNS0095612	Silvery flower (diploied) 3	0.519
	CNS0095613	Golden flower (tetraploid) 1	0.120
	CNS0095614	Golden flower (tetraploid) 2	0.466
	CNS0095615	Golden flower (tetraploid) 3	0.157
CRA001975	CRR073297	Stem 1	4.291
	CRR073298	Stem 2	2.858
	CRR073299	Stem 3	1.055
	CRR073300	Leaf 1	2.737
	CRR073301	Leaf 2	2.618
	CRR073302	Leaf 3	0.757
	CRR073303	Juvenile bud 1	0.387
	CRR073304	Juvenile bud 2	0.191
	CRR073305	Juvenile bud 3	0.230
	CRR073306	Third green 1	0.168
	CRR073307	Third green 2	0.074
	CRR073308	Third green 3	0.421
	CRR073309	Second white 1	0.000
	CRR073310	Second white 2	0.000
	CRR073311	Second white 3	0.283
	CRR073312	Silver flowering 1	0.000
	CRR073313	Silver flowering 2	0.000
	CRR073314	Silver flowering 3	0.223
	CRR073315	Gold flowering 1	0.000
	CRR073316	Gold flowering 2	0.000
	CRR073317	Gold flowering 3	0.000
	CRR073318	Tawny withering 1	0.045
	CRR073319	Tawny withering 2	6.111
	CRR073320	Tawny withering 3	2.890