Gene detail

Detail information of GWHGAAZE010919

Functional Annotation

Database	Orthologs	E value	Annotation
Nr	XP_004236006.1	7.22816E-66	PREDICTED: vesicle transport v-SNARE 11 [Solanum lycopersicum]
Swissprot	tr\|Q9SEL6\|VTI11_ARATH	1E-57	Vesicle transport v-SNARE 11
trEMBL	tr\|K4BL78\|K4BL78_SOLLC	3E-66	Uncharacterized protein {ECO:0000313\|EnsemblPlants:Solyc03g115760.2.1}
TAIR10	AT5G39510.1	9E-47	Vesicle transport v-SNARE family protein

Location And Transcript Sequence (JBrowse)

Scaffold	Type	Start	End	Strand
GWHAAZE00000003	gene	35014702	35021624	-
GWHAAZE00000003	mRNA	35014702	35021624	-
GWHAAZE00000003	exon	35021445	35021624	-
GWHAAZE00000003	exon	35020957	35021121	-
GWHAAZE00000003	exon	35014702	35014788	-
GWHAAZE00000003	CDS	35021445	35021624	-
GWHAAZE00000003	CDS	35020957	35021121	-
GWHAAZE00000003	CDS	35014702	35014788	-

Transcript Sequence
>GWHTAAZE010931 ATGGACCTTGAGACGAGAATTTTGCAACCAAATGTGAAGGCTGTACTCCTTGCTAAGTTTAGGGAATATAAATCTGATCTAAACAATCTGAAGAGTGACGTTAAACAAATTCAATCAACTAACTTAAATCAGGCTGCACGGGATGAGTTGTTGGAATCAAGGATGGCTGATACACAAACTGTATCAATGGATCAAAGAGCGAGATTATCAATGTTGACTGAAAGATTAAACAAGTCGAGTGACAGGGTGAGGGATAGTAGAAATACCACGTTGGAGATAGAAGATCTTGGTGTTTTAATTCTTCACGATCTCCACCAACAGTGCCAGTCTCTCTTACATGCCCAATTTCAACTCCATGGAGTGGGTGACAACATAAGCAAGAGTAAGAAAATCTTGACTACCATGTCAAAAAGAATGAGCAGGACCAAGTAG

Network for GWHGAAZE010919

Network category	Network	Top300 PCC genelist
Coexpression Positive	Network	Top300 PCC genelist
Coexpression Negative	Network	Top300 PCC genelist

Functional Module

Module ID	Function Annotation
CFinderModule0080	Transcription factor B3 family Transcription factor B3 map04130 SNARE interactions in vesicular transport map04138 Autophagy - yeast GO:0016192 vesicle-mediated transport GOslim:biological_process GO:0006886 intracellular protein transport GOslim:biological_process

Protein Structure

Pfam accession	Pfam name	Alignment start	Alignment end	E-value
PF05008.16	V-SNARE	1	36	5.30E-07
PF12352.9	V-SNARE_C	74	139	3.40E-16

Protein Sequence

Gene family

Gene family	subfamily
--	--

KEGG pathway

KO	Enzyme	pathway	mapID
K08493	VTI1	SNARE interactions in vesicular transport	map04130
K08493	VTI1	Autophagy - yeast	map04138

Gene Ontology

GO term	Ontology	Name
GO:0006886	biological_process	intracellular protein transport
GO:0016192	biological_process	vesicle-mediated transport
GO:0016020	cellular_component	membrane

Expression pattern

Expression pattern detail

SRP	Sample	Description	TPM
SRP075780	SRR3591705	youngest leaf	0.000
	SRR3591706	second leaf	0.000
	SRR3591707	mature leaf	0.000
	SRR3591708	Shoot apex	0.000
	SRR3591709	Stem	0.000
	SRR3591710	White floral bud	0.331
	SRR3591711	White flower	1.352
	SRR3591712	Green floral bud	0.000
	SRR3591713	Yellow flower	3.833
SRP173429	SRR8316895	Juvenile bud stage	0.000
	SRR8316896	Juvenile bud stage	0.000
	SRR8316897	Juvenile bud stage	0.000
	SRR8316894	Third green stage	0.000
	SRR8316900	Third green stage	0.000
	SRR8316901	Third green stage	0.000
	SRR8316898	Complete white stage	0.000
	SRR8316899	Complete white stage	0.000
	SRR8316903	Complete white stage	0.000
	SRR8316902	Silver flowering stage	0.000
	SRR8316904	Silver flowering stage	0.159
	SRR8316905	Silver flowering stage	0.038
	SRR8316906	Gold flowering stage	0.085
	SRR8316907	Gold flowering stage	0.501
	SRR8316908	Gold flowering stage	0.535
SRP132670	SRR6706286	Control	0.000
	SRR6706287	Light intensity 50%	0.000
	SRR6706288	Light intensity 20%	0.000
CNP0000432	CNS0095592	Slightly white alabastrum(diploid) 1	0.000
	CNS0095593	Slightly white alabastrum(diploid) 2	0.000
	CNS0095594	Slightly white alabastrum(diploid) 3	0.000
	CNS0095595	Whole white alabastrum(diploid) 2	0.000
	CNS0095596	Whole white alabastrum(diploid) 3	0.000
	CNS0095597	Whole white alabastrum(diploid) 4	0.000
	CNS0095598	Silvery flower (diploied) 1	0.103
	CNS0095599	Silvery flower (diploied) 2	0.000
	CNS0095600	Silvery flower (diploied) 3	0.000
	CNS0095601	Golden flower (diploid) 1	0.000
	CNS0095602	Golden flower (diploid) 2	0.000
	CNS0095603	Golden flower (diploid) 3	0.000
	CNS0095604	Slightly white alabastrum(tetraploid) 1	0.000
	CNS0095605	Slightly white alabastrum(tetraploid) 2	0.000
	CNS0095606	Slightly white alabastrum(tetraploid) 3	0.000
	CNS0095607	Whole white alabastrum(tetraploid) 1	0.000
	CNS0095608	Whole white alabastrum(tetraploid) 2	0.000
	CNS0095609	Whole white alabastrum(tetraploid) 3	0.000
	CNS0095610	Silvery flower (diploied) 1	0.240
	CNS0095611	Silvery flower (diploied) 2	0.688
	CNS0095612	Silvery flower (diploied) 3	2.748
	CNS0095613	Golden flower (tetraploid) 1	0.000
	CNS0095614	Golden flower (tetraploid) 2	0.059
	CNS0095615	Golden flower (tetraploid) 3	0.625
CRA001975	CRR073297	Stem 1	0.000
	CRR073298	Stem 2	0.000
	CRR073299	Stem 3	0.000
	CRR073300	Leaf 1	0.000
	CRR073301	Leaf 2	0.000
	CRR073302	Leaf 3	0.000
	CRR073303	Juvenile bud 1	0.000
	CRR073304	Juvenile bud 2	0.000
	CRR073305	Juvenile bud 3	0.000
	CRR073306	Third green 1	0.015
	CRR073307	Third green 2	0.064
	CRR073308	Third green 3	0.000
	CRR073309	Second white 1	0.000
	CRR073310	Second white 2	0.000
	CRR073311	Second white 3	0.004
	CRR073312	Silver flowering 1	0.382
	CRR073313	Silver flowering 2	0.000
	CRR073314	Silver flowering 3	0.000
	CRR073315	Gold flowering 1	0.000
	CRR073316	Gold flowering 2	0.000
	CRR073317	Gold flowering 3	0.000
	CRR073318	Tawny withering 1	0.000
	CRR073319	Tawny withering 2	0.000
	CRR073320	Tawny withering 3	0.000