Gene detail

Detail information of GWHGAAZE012210

Functional Annotation

Database	Orthologs	E value	Annotation
Nr	CDP19543.1	1.23346E-61	unnamed protein product [Coffea canephora]
Swissprot	tr\|O82248\|NFYB5_ARATH	3E-53	Nuclear transcription factor Y subunit B-5
trEMBL	tr\|A0A068VIP2\|A0A068VIP2_COFCA	5E-62	Coffea canephora DH200=94 genomic scaffold, scaffold_540 {ECO:0000313\|EMBL:CDP19543.1}
TAIR10	AT2G47810.1	5E-43	nuclear factor Y, subunit B5

Location And Transcript Sequence (JBrowse)

Scaffold	Type	Start	End	Strand
GWHAAZE00000003	gene	81809849	81810358	-
GWHAAZE00000003	mRNA	81809849	81810358	-
GWHAAZE00000003	exon	81809849	81810358	-
GWHAAZE00000003	CDS	81809849	81810358	-

Transcript Sequence
>GWHTAAZE012224 ATGGGTGATAAAATAGCTGGAGCTGGTCCTTCAAGGGATCATGAATTAGATGGTGGTGGTGGCCATGGTAGTAATAGCATCTTCAAAGAACAAGACAGGCTATTACCAATAGCCAACGTGGGCAGAATCATGAAGCAAAATCTCCCACCAAACGCGAAGATAGCCAAAGAAGCGAAAGAAACAATGCAAGAATGCGTGTCTGAGTTCATAAGCTTCGTGACCAGCGAGGCCTCGGATAAGTGCAAGAAAGAGAGGCGAAAGACGGTCAACGGCGATGACATATGTTGGGCTTTGGGCACACTAGGGTTTGATGACTATGCTCCCCCACTCAAGAGGTACATGGTTAGGTATAGAGAGCTTGAAGGCGACCAAAGAGTTCATCAAGAAAACCCTAGCAATAGTGAAGAACAAGATCAAGATTACTCATTTAGAAATAATAATACCCAATTTGGGGATCAACAAGGTGAAGGCTCGAATCAAGTTGGCTCTCGGACATCAAGACCATTTTAG

Network for GWHGAAZE012210

Network category	Network	Top300 PCC genelist
Coexpression Positive	Network	Top300 PCC genelist
Coexpression Negative	Network	Top300 PCC genelist

Functional Module

Module ID	Function Annotation

Protein Structure

Pfam accession	Pfam name	Alignment start	Alignment end	E-value
PF00808.24	CBFD_NFYB_HMF	34	98	1.50E-27

Protein Sequence

Gene family

Gene family	subfamily
Transcription Factors Family	NF-YB

KEGG pathway

KO	Enzyme	pathway	mapID
K08065	NFYB, HAP3	Antigen processing and presentation	map04612

Gene Ontology

GO term	Ontology	Name
GO:0006355	biological_process	regulation of transcription, DNA-templated
GO:0005634	cellular_component	nucleus
GO:0043565	molecular_function	sequence-specific DNA binding
GO:0046982	molecular_function	protein heterodimerization activity

Expression pattern

Expression pattern detail

SRP	Sample	Description	TPM
SRP075780	SRR3591705	youngest leaf	0.107
	SRR3591706	second leaf	0.000
	SRR3591707	mature leaf	0.245
	SRR3591708	Shoot apex	0.875
	SRR3591709	Stem	0.000
	SRR3591710	White floral bud	0.000
	SRR3591711	White flower	0.000
	SRR3591712	Green floral bud	0.094
	SRR3591713	Yellow flower	0.177
SRP173429	SRR8316895	Juvenile bud stage	0.409
	SRR8316896	Juvenile bud stage	0.229
	SRR8316897	Juvenile bud stage	0.210
	SRR8316894	Third green stage	0.392
	SRR8316900	Third green stage	0.159
	SRR8316901	Third green stage	0.061
	SRR8316898	Complete white stage	0.165
	SRR8316899	Complete white stage	0.606
	SRR8316903	Complete white stage	0.162
	SRR8316902	Silver flowering stage	0.036
	SRR8316904	Silver flowering stage	0.170
	SRR8316905	Silver flowering stage	0.000
	SRR8316906	Gold flowering stage	0.191
	SRR8316907	Gold flowering stage	0.000
	SRR8316908	Gold flowering stage	0.026
SRP132670	SRR6706286	Control	0.262
	SRR6706287	Light intensity 50%	0.022
	SRR6706288	Light intensity 20%	0.100
CNP0000432	CNS0095592	Slightly white alabastrum(diploid) 1	2.325
	CNS0095593	Slightly white alabastrum(diploid) 2	1.255
	CNS0095594	Slightly white alabastrum(diploid) 3	0.380
	CNS0095595	Whole white alabastrum(diploid) 2	1.220
	CNS0095596	Whole white alabastrum(diploid) 3	0.678
	CNS0095597	Whole white alabastrum(diploid) 4	1.099
	CNS0095598	Silvery flower (diploied) 1	1.119
	CNS0095599	Silvery flower (diploied) 2	1.689
	CNS0095600	Silvery flower (diploied) 3	0.424
	CNS0095601	Golden flower (diploid) 1	0.000
	CNS0095602	Golden flower (diploid) 2	0.147
	CNS0095603	Golden flower (diploid) 3	0.512
	CNS0095604	Slightly white alabastrum(tetraploid) 1	1.322
	CNS0095605	Slightly white alabastrum(tetraploid) 2	1.584
	CNS0095606	Slightly white alabastrum(tetraploid) 3	0.667
	CNS0095607	Whole white alabastrum(tetraploid) 1	1.109
	CNS0095608	Whole white alabastrum(tetraploid) 2	0.696
	CNS0095609	Whole white alabastrum(tetraploid) 3	0.833
	CNS0095610	Silvery flower (diploied) 1	0.306
	CNS0095611	Silvery flower (diploied) 2	0.000
	CNS0095612	Silvery flower (diploied) 3	0.087
	CNS0095613	Golden flower (tetraploid) 1	0.349
	CNS0095614	Golden flower (tetraploid) 2	0.533
	CNS0095615	Golden flower (tetraploid) 3	0.525
CRA001975	CRR073297	Stem 1	1.105
	CRR073298	Stem 2	0.371
	CRR073299	Stem 3	0.586
	CRR073300	Leaf 1	0.000
	CRR073301	Leaf 2	0.089
	CRR073302	Leaf 3	0.060
	CRR073303	Juvenile bud 1	0.227
	CRR073304	Juvenile bud 2	0.050
	CRR073305	Juvenile bud 3	0.000
	CRR073306	Third green 1	0.000
	CRR073307	Third green 2	0.156
	CRR073308	Third green 3	0.314
	CRR073309	Second white 1	0.000
	CRR073310	Second white 2	0.000
	CRR073311	Second white 3	0.000
	CRR073312	Silver flowering 1	0.000
	CRR073313	Silver flowering 2	0.000
	CRR073314	Silver flowering 3	0.000
	CRR073315	Gold flowering 1	0.000
	CRR073316	Gold flowering 2	0.000
	CRR073317	Gold flowering 3	0.022
	CRR073318	Tawny withering 1	0.000
	CRR073319	Tawny withering 2	0.394
	CRR073320	Tawny withering 3	0.000