Gene detail

Detail information of GWHGAAZE013190

Functional Annotation

Database	Orthologs	E value	Annotation
Nr	XP_010684080.1	1.68727E-10	PREDICTED: isocitrate dehydrogenase [NAD] catalytic subunit 5, mitochondrial-like [Beta vulgaris subsp. vulgaris]
Swissprot	tr\|P29696\|LEU3_SOLTU	4E-12	3-isopropylmalate dehydrogenase, chloroplastic (Precursor)
trEMBL	tr\|W9SLH0\|W9SLH0_9ROSA	9E-11	Isocitrate dehydrogenase [NAD] subunit, mitochondrial {ECO:0000256\|RuleBase:RU361266}
TAIR10	AT3G09810.1	4E-10	isocitrate dehydrogenase VI

Location And Transcript Sequence (JBrowse)

Scaffold	Type	Start	End	Strand
GWHAAZE00000003	gene	98309148	98313897	+
GWHAAZE00000003	mRNA	98309148	98313897	+
GWHAAZE00000003	exon	98309148	98309200	+
GWHAAZE00000003	exon	98309365	98309467	+
GWHAAZE00000003	exon	98312406	98312448	+
GWHAAZE00000003	exon	98312933	98313042	+
GWHAAZE00000003	exon	98313829	98313897	+
GWHAAZE00000003	CDS	98309148	98309200	+
GWHAAZE00000003	CDS	98309365	98309467	+
GWHAAZE00000003	CDS	98312406	98312448	+
GWHAAZE00000003	CDS	98312933	98313042	+
GWHAAZE00000003	CDS	98313829	98313897	+

Transcript Sequence
>GWHTAAZE013204 GTATTCAAAATTGCGGATGTGCCAATTGAATGGGAAGAACACTATGTGGGAATACCTTGCTACGGTCTCGTTGGTTACAAGACACGTTATGATGATGTATATCTCACTACTATCCATGAAAACACTGAAGCAGAGTGCAGTGGTCTTGAGCATCAACTTGGGCTTAACACCAAGGTATCTGCATTTATTTTTCTCGGATCCAATTATCACACTTCATTTGATGTCTTCTTGGACAGCTGCAACATTGGGGAGGGAGGTATTGTGCTTGCCGAGGCTGTACATGGTTCAACACCTGATATTGCTGGAAAGAATATGACAAATCCAAACGGCTTTACTTTTGAGTTCGGTTTCAATGCTGTGCCATCTAAAGCTCGATGA

Network for GWHGAAZE013190

Network category	Network	Top300 PCC genelist
Coexpression Positive	Network	Top300 PCC genelist
Coexpression Negative	Network	Top300 PCC genelist

Functional Module

Module ID	Function Annotation

Protein Structure

Pfam accession	Pfam name	Alignment start	Alignment end	E-value
PF00180.21	Iso_dh	77	110	3.60E-08

Protein Sequence

Gene family

Gene family	subfamily
--	--

KEGG pathway

KO	Enzyme	pathway	mapID
K00030	IDH3	Metabolic pathways	map01100
		Biosynthesis of secondary metabolites	map01110
		Microbial metabolism in diverse environments	map01120
		Carbon metabolism	map01200
		2-Oxocarboxylic acid metabolism	map01210
		Biosynthesis of amino acids	map01230
		Citrate cycle	map00020

Gene Ontology

GO term	Ontology	Name
GO:0055114	biological_process	oxidation-reduction process
GO:0016616	molecular_function	oxidoreductase activity, acting on the CH-OH group of donors, NAD or NADP as acceptor

Expression pattern

Expression pattern detail

SRP	Sample	Description	TPM
SRP075780	SRR3591705	youngest leaf	0.000
	SRR3591706	second leaf	0.000
	SRR3591707	mature leaf	0.000
	SRR3591708	Shoot apex	0.000
	SRR3591709	Stem	0.017
	SRR3591710	White floral bud	0.000
	SRR3591711	White flower	0.000
	SRR3591712	Green floral bud	0.000
	SRR3591713	Yellow flower	0.000
SRP173429	SRR8316895	Juvenile bud stage	0.000
	SRR8316896	Juvenile bud stage	0.000
	SRR8316897	Juvenile bud stage	0.000
	SRR8316894	Third green stage	0.000
	SRR8316900	Third green stage	0.000
	SRR8316901	Third green stage	0.000
	SRR8316898	Complete white stage	0.000
	SRR8316899	Complete white stage	0.000
	SRR8316903	Complete white stage	0.000
	SRR8316902	Silver flowering stage	0.000
	SRR8316904	Silver flowering stage	0.000
	SRR8316905	Silver flowering stage	0.000
	SRR8316906	Gold flowering stage	0.000
	SRR8316907	Gold flowering stage	0.000
	SRR8316908	Gold flowering stage	0.000
SRP132670	SRR6706286	Control	0.000
	SRR6706287	Light intensity 50%	0.000
	SRR6706288	Light intensity 20%	0.000
CNP0000432	CNS0095592	Slightly white alabastrum(diploid) 1	0.000
	CNS0095593	Slightly white alabastrum(diploid) 2	0.000
	CNS0095594	Slightly white alabastrum(diploid) 3	0.000
	CNS0095595	Whole white alabastrum(diploid) 2	0.000
	CNS0095596	Whole white alabastrum(diploid) 3	0.000
	CNS0095597	Whole white alabastrum(diploid) 4	0.000
	CNS0095598	Silvery flower (diploied) 1	0.000
	CNS0095599	Silvery flower (diploied) 2	0.000
	CNS0095600	Silvery flower (diploied) 3	0.000
	CNS0095601	Golden flower (diploid) 1	0.000
	CNS0095602	Golden flower (diploid) 2	0.000
	CNS0095603	Golden flower (diploid) 3	0.000
	CNS0095604	Slightly white alabastrum(tetraploid) 1	0.000
	CNS0095605	Slightly white alabastrum(tetraploid) 2	0.000
	CNS0095606	Slightly white alabastrum(tetraploid) 3	0.000
	CNS0095607	Whole white alabastrum(tetraploid) 1	0.082
	CNS0095608	Whole white alabastrum(tetraploid) 2	0.618
	CNS0095609	Whole white alabastrum(tetraploid) 3	0.199
	CNS0095610	Silvery flower (diploied) 1	0.000
	CNS0095611	Silvery flower (diploied) 2	0.079
	CNS0095612	Silvery flower (diploied) 3	0.299
	CNS0095613	Golden flower (tetraploid) 1	0.000
	CNS0095614	Golden flower (tetraploid) 2	0.000
	CNS0095615	Golden flower (tetraploid) 3	0.316
CRA001975	CRR073297	Stem 1	0.000
	CRR073298	Stem 2	0.000
	CRR073299	Stem 3	0.000
	CRR073300	Leaf 1	0.000
	CRR073301	Leaf 2	0.000
	CRR073302	Leaf 3	0.000
	CRR073303	Juvenile bud 1	0.000
	CRR073304	Juvenile bud 2	0.000
	CRR073305	Juvenile bud 3	0.000
	CRR073306	Third green 1	0.000
	CRR073307	Third green 2	0.104
	CRR073308	Third green 3	0.089
	CRR073309	Second white 1	0.000
	CRR073310	Second white 2	0.000
	CRR073311	Second white 3	0.000
	CRR073312	Silver flowering 1	0.000
	CRR073313	Silver flowering 2	0.000
	CRR073314	Silver flowering 3	0.000
	CRR073315	Gold flowering 1	0.000
	CRR073316	Gold flowering 2	0.000
	CRR073317	Gold flowering 3	0.000
	CRR073318	Tawny withering 1	0.007
	CRR073319	Tawny withering 2	0.000
	CRR073320	Tawny withering 3	0.000