Gene detail

Detail information of GWHGAAZE013452

Functional Annotation

Database	Orthologs	E value	Annotation
Nr	XP_008230298.1	3.00902E-40	PREDICTED: E3 ubiquitin-protein ligase At3g02290-like [Prunus mume]
Swissprot	tr\|Q8LE94\|RING3_ARATH	2E-25	E3 ubiquitin-protein ligase At3g02290
trEMBL	tr\|M5WZ55\|M5WZ55_PRUPE	2E-40	Uncharacterized protein {ECO:0000313\|EMBL:EMJ18954.1}
TAIR10	AT5G38895.3	9E-22	RING/U-box superfamily protein

Location And Transcript Sequence (JBrowse)

Scaffold	Type	Start	End	Strand
GWHAAZE00000003	gene	102811238	102811868	+
GWHAAZE00000003	mRNA	102811238	102811868	+
GWHAAZE00000003	exon	102811238	102811622	+
GWHAAZE00000003	exon	102811723	102811868	+
GWHAAZE00000003	CDS	102811238	102811622	+
GWHAAZE00000003	CDS	102811723	102811868	+

Transcript Sequence
>GWHTAAZE013466 TATGAAGCTCTATTTGCCAGAGAAGAAGTGCATACGACTCCTTCATCTGATCAAGGGGCATCCTCAAATTCTCTAGCACCAGTTAACAGCTCAACCGACATTACTAGGACCAATGGATTTTCACAACCGCAAAACAATGTTATAATTAGGGGACCAGATAAAGACACCGATCATTTGCGCATGGGACCAGAACCACTGGAAGGACACACTTGTCAATTAATCCCAAATTTGTTAAGTCGAAGACGTAAACCAAATGGATCTCATTGTGAAGGAGGGTCAGAAGAATGTGGTTCTCAATCCTCTGTGAAGGACTTGTCATCAACAGTGGATTCATGCGCCTATTTTTCCTCAGAGGACGAGGACGACTGTCCTACATGCCTTGAAGAATATACCCCAGAGAATCCAAAGATTATGACAAAATGTTCGCACCATTATCACCTTAGTTGTATCCTCGAGTGGATGGAGAGAAGTGAAACCTGTCCTGTTTGTGGCATGGTAACATGTTTCTTCTTGTTTGAAGCATTATACTGA

Network for GWHGAAZE013452

Network category	Network	Top300 PCC genelist
Coexpression Positive	Network	Top300 PCC genelist
Coexpression Negative	Network	Top300 PCC genelist

Functional Module

Module ID	Function Annotation

Protein Structure

Pfam accession	Pfam name	Alignment start	Alignment end	E-value
PF13639.7	zf-RING_2	121	163	5.20E-11

Protein Sequence

Gene family

Gene family	subfamily
Ubiquitin Family	RING
Ubiquitin Family	U-box

KEGG pathway

KO	Enzyme	pathway	mapID
--	--	--	--

Gene Ontology

GO term	Ontology	Name
GO:0008270	molecular_function	zinc ion binding

Expression pattern

Expression pattern detail

SRP	Sample	Description	TPM
SRP075780	SRR3591705	youngest leaf	0.000
	SRR3591706	second leaf	0.000
	SRR3591707	mature leaf	0.000
	SRR3591708	Shoot apex	0.000
	SRR3591709	Stem	0.000
	SRR3591710	White floral bud	0.553
	SRR3591711	White flower	0.000
	SRR3591712	Green floral bud	0.799
	SRR3591713	Yellow flower	0.190
SRP173429	SRR8316895	Juvenile bud stage	11.748
	SRR8316896	Juvenile bud stage	5.310
	SRR8316897	Juvenile bud stage	0.568
	SRR8316894	Third green stage	0.505
	SRR8316900	Third green stage	0.385
	SRR8316901	Third green stage	0.426
	SRR8316898	Complete white stage	0.000
	SRR8316899	Complete white stage	0.000
	SRR8316903	Complete white stage	0.000
	SRR8316902	Silver flowering stage	0.000
	SRR8316904	Silver flowering stage	0.000
	SRR8316905	Silver flowering stage	0.125
	SRR8316906	Gold flowering stage	0.000
	SRR8316907	Gold flowering stage	0.000
	SRR8316908	Gold flowering stage	0.000
SRP132670	SRR6706286	Control	0.033
	SRR6706287	Light intensity 50%	0.135
	SRR6706288	Light intensity 20%	0.176
CNP0000432	CNS0095592	Slightly white alabastrum(diploid) 1	1.901
	CNS0095593	Slightly white alabastrum(diploid) 2	0.872
	CNS0095594	Slightly white alabastrum(diploid) 3	4.963
	CNS0095595	Whole white alabastrum(diploid) 2	0.741
	CNS0095596	Whole white alabastrum(diploid) 3	2.401
	CNS0095597	Whole white alabastrum(diploid) 4	1.604
	CNS0095598	Silvery flower (diploied) 1	0.000
	CNS0095599	Silvery flower (diploied) 2	1.234
	CNS0095600	Silvery flower (diploied) 3	0.000
	CNS0095601	Golden flower (diploid) 1	0.000
	CNS0095602	Golden flower (diploid) 2	0.170
	CNS0095603	Golden flower (diploid) 3	0.138
	CNS0095604	Slightly white alabastrum(tetraploid) 1	0.732
	CNS0095605	Slightly white alabastrum(tetraploid) 2	1.003
	CNS0095606	Slightly white alabastrum(tetraploid) 3	0.000
	CNS0095607	Whole white alabastrum(tetraploid) 1	1.861
	CNS0095608	Whole white alabastrum(tetraploid) 2	0.814
	CNS0095609	Whole white alabastrum(tetraploid) 3	0.773
	CNS0095610	Silvery flower (diploied) 1	0.000
	CNS0095611	Silvery flower (diploied) 2	0.000
	CNS0095612	Silvery flower (diploied) 3	0.243
	CNS0095613	Golden flower (tetraploid) 1	0.244
	CNS0095614	Golden flower (tetraploid) 2	0.190
	CNS0095615	Golden flower (tetraploid) 3	0.386
CRA001975	CRR073297	Stem 1	3.390
	CRR073298	Stem 2	1.976
	CRR073299	Stem 3	1.083
	CRR073300	Leaf 1	0.134
	CRR073301	Leaf 2	0.604
	CRR073302	Leaf 3	0.390
	CRR073303	Juvenile bud 1	0.000
	CRR073304	Juvenile bud 2	0.000
	CRR073305	Juvenile bud 3	0.432
	CRR073306	Third green 1	0.000
	CRR073307	Third green 2	0.000
	CRR073308	Third green 3	0.000
	CRR073309	Second white 1	0.000
	CRR073310	Second white 2	0.000
	CRR073311	Second white 3	0.000
	CRR073312	Silver flowering 1	0.000
	CRR073313	Silver flowering 2	0.361
	CRR073314	Silver flowering 3	0.000
	CRR073315	Gold flowering 1	0.000
	CRR073316	Gold flowering 2	0.000
	CRR073317	Gold flowering 3	0.073
	CRR073318	Tawny withering 1	0.000
	CRR073319	Tawny withering 2	0.000
	CRR073320	Tawny withering 3	0.146