Gene detail

Detail information of GWHGAAZE013569

Functional Annotation

Database	Orthologs	E value	Annotation
Nr	XP_009794958.1	4.54573E-51	PREDICTED: serine/threonine-protein phosphatase PP2A catalytic subunit-like [Nicotiana sylvestris]
Swissprot	tr\|Q9ZSE4\|PP2A_HEVBR	1E-48	Serine/threonine-protein phosphatase PP2A catalytic subunit
trEMBL	tr\|A0A068TWD7\|A0A068TWD7_COFCA	8E-51	Serine/threonine-protein phosphatase {ECO:0000256\|RuleBase:RU004273}
TAIR10	AT1G10430.1	1E-39	protein phosphatase 2A-2

Location And Transcript Sequence (JBrowse)

Scaffold	Type	Start	End	Strand
GWHAAZE00000003	gene	104543942	104546347	+
GWHAAZE00000003	mRNA	104543942	104546347	+
GWHAAZE00000003	exon	104543942	104544091	+
GWHAAZE00000003	exon	104546189	104546347	+
GWHAAZE00000003	CDS	104543942	104544091	+
GWHAAZE00000003	CDS	104546189	104546347	+

Transcript Sequence
>GWHTAAZE013583 ATGCCTTCTCACGCGGATCTGGATCGGCAGATCGAGCAATTGATGGAGTGCAAGCCTCTAACGGAGGCCGAAGTGAAGACTCTATGCGATCAAGCTAGGGCTATTCTTGTGGAGGAATGGAATGTGCAGCCTGTCAAGTGTCCCGTCACGTATGTTCTAGCACTTACTAATGACTATTCAATTAATGCAGATCGTGGATACTATTCGGTGGAGACTGTCACATTATTGGTGGCTTTAAAAGTTCGTTATAGAGATAGAATCACAATCCTTAGAGGAAATCATGAAAGCCGGCAAATTACTCAAGTGTAA

Network for GWHGAAZE013569

Network category	Network	Top300 PCC genelist
Coexpression Positive	Network	Top300 PCC genelist
Coexpression Negative	Network	Top300 PCC genelist

Functional Module

Module ID	Function Annotation

Protein Structure

Pfam accession	Pfam name	Alignment start	Alignment end	E-value
--	--	--	--	--

Protein Sequence

Gene family

Gene family	subfamily
--	--

KEGG pathway

KO	Enzyme	pathway	mapID
K04382	PPP2C	mRNA surveillance pathway	map03015
		MAPK signaling pathway - fly	map04013
		TGF-beta signaling pathway	map04350
		Hippo signaling pathway	map04390
		Hippo signaling pathway - fly	map04391
		Sphingolipid signaling pathway	map04071
		PI3K-Akt signaling pathway	map04151
		AMPK signaling pathway	map04152
		Autophagy - animal	map04140
		Autophagy - yeast	map04138
		Autophagy - other	map04136
		Cell cycle - yeast	map04111
		Meiosis - yeast	map04113
		Oocyte meiosis	map04114
		Tight junction	map04530
		Adrenergic signaling in cardiomyocytes	map04261
		Dopaminergic synapse	map04728
		Long-term depression	map04730

Gene Ontology

GO term	Ontology	Name
GO:0016787	molecular_function	hydrolase activity

Expression pattern

Expression pattern detail

SRP	Sample	Description	TPM
SRP075780	SRR3591705	youngest leaf	61.288
	SRR3591706	second leaf	43.268
	SRR3591707	mature leaf	60.437
	SRR3591708	Shoot apex	41.610
	SRR3591709	Stem	60.480
	SRR3591710	White floral bud	60.439
	SRR3591711	White flower	60.677
	SRR3591712	Green floral bud	64.858
	SRR3591713	Yellow flower	54.865
SRP173429	SRR8316895	Juvenile bud stage	40.232
	SRR8316896	Juvenile bud stage	53.085
	SRR8316897	Juvenile bud stage	22.116
	SRR8316894	Third green stage	23.762
	SRR8316900	Third green stage	82.459
	SRR8316901	Third green stage	79.524
	SRR8316898	Complete white stage	54.713
	SRR8316899	Complete white stage	119.161
	SRR8316903	Complete white stage	67.923
	SRR8316902	Silver flowering stage	43.296
	SRR8316904	Silver flowering stage	57.712
	SRR8316905	Silver flowering stage	25.966
	SRR8316906	Gold flowering stage	89.247
	SRR8316907	Gold flowering stage	83.057
	SRR8316908	Gold flowering stage	97.618
SRP132670	SRR6706286	Control	74.171
	SRR6706287	Light intensity 50%	81.752
	SRR6706288	Light intensity 20%	89.078
CNP0000432	CNS0095592	Slightly white alabastrum(diploid) 1	33.808
	CNS0095593	Slightly white alabastrum(diploid) 2	38.929
	CNS0095594	Slightly white alabastrum(diploid) 3	28.288
	CNS0095595	Whole white alabastrum(diploid) 2	41.143
	CNS0095596	Whole white alabastrum(diploid) 3	42.964
	CNS0095597	Whole white alabastrum(diploid) 4	36.288
	CNS0095598	Silvery flower (diploied) 1	39.408
	CNS0095599	Silvery flower (diploied) 2	28.632
	CNS0095600	Silvery flower (diploied) 3	75.394
	CNS0095601	Golden flower (diploid) 1	36.873
	CNS0095602	Golden flower (diploid) 2	61.440
	CNS0095603	Golden flower (diploid) 3	59.138
	CNS0095604	Slightly white alabastrum(tetraploid) 1	49.654
	CNS0095605	Slightly white alabastrum(tetraploid) 2	45.045
	CNS0095606	Slightly white alabastrum(tetraploid) 3	67.867
	CNS0095607	Whole white alabastrum(tetraploid) 1	57.831
	CNS0095608	Whole white alabastrum(tetraploid) 2	52.285
	CNS0095609	Whole white alabastrum(tetraploid) 3	75.398
	CNS0095610	Silvery flower (diploied) 1	66.578
	CNS0095611	Silvery flower (diploied) 2	57.709
	CNS0095612	Silvery flower (diploied) 3	62.535
	CNS0095613	Golden flower (tetraploid) 1	38.979
	CNS0095614	Golden flower (tetraploid) 2	58.640
	CNS0095615	Golden flower (tetraploid) 3	51.965
CRA001975	CRR073297	Stem 1	42.057
	CRR073298	Stem 2	45.574
	CRR073299	Stem 3	55.461
	CRR073300	Leaf 1	62.733
	CRR073301	Leaf 2	66.030
	CRR073302	Leaf 3	83.423
	CRR073303	Juvenile bud 1	84.597
	CRR073304	Juvenile bud 2	71.407
	CRR073305	Juvenile bud 3	63.387
	CRR073306	Third green 1	86.305
	CRR073307	Third green 2	83.016
	CRR073308	Third green 3	69.074
	CRR073309	Second white 1	48.614
	CRR073310	Second white 2	55.444
	CRR073311	Second white 3	40.097
	CRR073312	Silver flowering 1	41.424
	CRR073313	Silver flowering 2	43.816
	CRR073314	Silver flowering 3	48.587
	CRR073315	Gold flowering 1	24.139
	CRR073316	Gold flowering 2	29.210
	CRR073317	Gold flowering 3	21.890
	CRR073318	Tawny withering 1	57.372
	CRR073319	Tawny withering 2	53.968
	CRR073320	Tawny withering 3	58.909