Gene detail

Detail information of GWHGAAZE013905

Functional Annotation

Database	Orthologs	E value	Annotation
Nr	CDP07401.1	1.78873E-75	unnamed protein product [Coffea canephora]
Swissprot	tr\|Q84WL9\|AP2S_ARATH	7E-74	AP-2 complex subunit sigma
trEMBL	tr\|A0A068UFZ7\|A0A068UFZ7_COFCA	7E-76	Coffea canephora DH200=94 genomic scaffold, scaffold_26 {ECO:0000313\|EMBL:CDP07401.1}
TAIR10	AT1G47830.1	2E-58	SNARE-like superfamily protein

Location And Transcript Sequence (JBrowse)

Scaffold	Type	Start	End	Strand
GWHAAZE00000004	gene	2529087	2531516	-
GWHAAZE00000004	mRNA	2529087	2531516	-
GWHAAZE00000004	exon	2531514	2531516	-
GWHAAZE00000004	exon	2531314	2531412	-
GWHAAZE00000004	exon	2530573	2530746	-
GWHAAZE00000004	exon	2530311	2530361	-
GWHAAZE00000004	exon	2529378	2529437	-
GWHAAZE00000004	exon	2529087	2529128	-
GWHAAZE00000004	CDS	2531514	2531516	-
GWHAAZE00000004	CDS	2531314	2531412	-
GWHAAZE00000004	CDS	2530573	2530746	-
GWHAAZE00000004	CDS	2530311	2530361	-
GWHAAZE00000004	CDS	2529378	2529437	-
GWHAAZE00000004	CDS	2529087	2529128	-

Transcript Sequence
>GWHTAAZE013919 ATGATCCGGTTCATATTGCTTCAAAACAGGCAAGGGAAGACTCGTCTCGCCAAGTATTACGTCCCCCTCGAGGAATCCGAGAAGCACAAGGTCGAATACGAGTTCCGTACCCATAAGGTTATCTACAGGCGATATGCTGGATTGTTTTTCTCACTTTGTGTTGATATAACAGACAACGAGCTAGCATATTTAGAATGCATCCACTTATTTGTTGAGATTTTGGATCACTTTTTCAGCAATGTGTGTGAGCTTGATTTGGTTTTTAACTTTCACAAGCACAAGGGTTTGAAGATGACATTTCCTCTTCCATATGAAATTGGTTGCCTTGTATATTTGATACTCGATGAGTTCATCCTTGCTGGGGAACTCCAAGAAACAAGCAAGAAGGCAATTATAGAGAGAATGGGGGAGTTGGAAAAACAGGAGTGA

Network for GWHGAAZE013905

Network category	Network	Top300 PCC genelist
Coexpression Positive	Network	Top300 PCC genelist
Coexpression Negative	Network	Top300 PCC genelist

Functional Module

Module ID	Function Annotation

Protein Structure

Pfam accession	Pfam name	Alignment start	Alignment end	E-value
PF01217.21	Clat_adaptor_s	1	31	2.40E-06
PF01217.21	Clat_adaptor_s	34	92	3.90E-23

Protein Sequence

Gene family

Gene family	subfamily
--	--

KEGG pathway

KO	Enzyme	pathway	mapID
K11827	AP2S1	Endocytosis	map04144
		Endocrine and other factor-regulated calcium reabsorption	map04961
		Synaptic vesicle cycle	map04721

Gene Ontology

GO term	Ontology	Name
GO:0015031	biological_process	protein transport

Expression pattern

Expression pattern detail

SRP	Sample	Description	TPM
SRP075780	SRR3591705	youngest leaf	99.602
	SRR3591706	second leaf	55.715
	SRR3591707	mature leaf	47.007
	SRR3591708	Shoot apex	61.459
	SRR3591709	Stem	90.983
	SRR3591710	White floral bud	96.417
	SRR3591711	White flower	108.390
	SRR3591712	Green floral bud	120.582
	SRR3591713	Yellow flower	97.083
SRP173429	SRR8316895	Juvenile bud stage	29.830
	SRR8316896	Juvenile bud stage	42.111
	SRR8316897	Juvenile bud stage	19.526
	SRR8316894	Third green stage	23.735
	SRR8316900	Third green stage	86.175
	SRR8316901	Third green stage	71.113
	SRR8316898	Complete white stage	27.483
	SRR8316899	Complete white stage	80.144
	SRR8316903	Complete white stage	43.398
	SRR8316902	Silver flowering stage	33.241
	SRR8316904	Silver flowering stage	42.956
	SRR8316905	Silver flowering stage	19.933
	SRR8316906	Gold flowering stage	67.178
	SRR8316907	Gold flowering stage	64.942
	SRR8316908	Gold flowering stage	70.217
SRP132670	SRR6706286	Control	55.767
	SRR6706287	Light intensity 50%	52.832
	SRR6706288	Light intensity 20%	53.474
CNP0000432	CNS0095592	Slightly white alabastrum(diploid) 1	45.592
	CNS0095593	Slightly white alabastrum(diploid) 2	44.830
	CNS0095594	Slightly white alabastrum(diploid) 3	43.834
	CNS0095595	Whole white alabastrum(diploid) 2	50.864
	CNS0095596	Whole white alabastrum(diploid) 3	50.761
	CNS0095597	Whole white alabastrum(diploid) 4	40.519
	CNS0095598	Silvery flower (diploied) 1	33.578
	CNS0095599	Silvery flower (diploied) 2	35.067
	CNS0095600	Silvery flower (diploied) 3	51.897
	CNS0095601	Golden flower (diploid) 1	39.619
	CNS0095602	Golden flower (diploid) 2	41.781
	CNS0095603	Golden flower (diploid) 3	42.984
	CNS0095604	Slightly white alabastrum(tetraploid) 1	52.106
	CNS0095605	Slightly white alabastrum(tetraploid) 2	41.125
	CNS0095606	Slightly white alabastrum(tetraploid) 3	52.545
	CNS0095607	Whole white alabastrum(tetraploid) 1	38.807
	CNS0095608	Whole white alabastrum(tetraploid) 2	43.825
	CNS0095609	Whole white alabastrum(tetraploid) 3	62.857
	CNS0095610	Silvery flower (diploied) 1	42.941
	CNS0095611	Silvery flower (diploied) 2	40.297
	CNS0095612	Silvery flower (diploied) 3	35.419
	CNS0095613	Golden flower (tetraploid) 1	32.072
	CNS0095614	Golden flower (tetraploid) 2	45.786
	CNS0095615	Golden flower (tetraploid) 3	30.809
CRA001975	CRR073297	Stem 1	37.293
	CRR073298	Stem 2	37.256
	CRR073299	Stem 3	39.590
	CRR073300	Leaf 1	44.600
	CRR073301	Leaf 2	51.651
	CRR073302	Leaf 3	49.934
	CRR073303	Juvenile bud 1	48.828
	CRR073304	Juvenile bud 2	43.404
	CRR073305	Juvenile bud 3	37.040
	CRR073306	Third green 1	28.950
	CRR073307	Third green 2	30.323
	CRR073308	Third green 3	24.357
	CRR073309	Second white 1	29.116
	CRR073310	Second white 2	25.536
	CRR073311	Second white 3	26.865
	CRR073312	Silver flowering 1	14.301
	CRR073313	Silver flowering 2	23.268
	CRR073314	Silver flowering 3	17.589
	CRR073315	Gold flowering 1	17.488
	CRR073316	Gold flowering 2	20.023
	CRR073317	Gold flowering 3	16.397
	CRR073318	Tawny withering 1	47.392
	CRR073319	Tawny withering 2	31.849
	CRR073320	Tawny withering 3	40.535