Gene detail

Detail information of GWHGAAZE014119

Functional Annotation

Database	Orthologs	E value	Annotation
Nr	CDP01305.1	2.67002E-73	unnamed protein product [Coffea canephora]
Swissprot	tr\|Q9FH94\|ERF10_ARATH	7E-52	Ethylene-responsive transcription factor ERF010
trEMBL	tr\|A0A068TYD8\|A0A068TYD8_COFCA	1E-73	Coffea canephora DH200=94 genomic scaffold, scaffold_6 {ECO:0000313\|EMBL:CDP01305.1}
TAIR10	AT5G67190.1	5E-42	DREB and EAR motif protein 2

Location And Transcript Sequence (JBrowse)

Scaffold	Type	Start	End	Strand
GWHAAZE00000004	gene	6223787	6224242	-
GWHAAZE00000004	mRNA	6223787	6224242	-
GWHAAZE00000004	exon	6223787	6224242	-
GWHAAZE00000004	CDS	6223787	6224242	-

Transcript Sequence
>GWHTAAZE014133 ATGGAAGGAGGAGGTGAGTGTTGTTCAACTACGATGGAAACTCAGAAAATTAGGAAGCAGCATAACAGGCAGCAAGACAAACCCTACAGAGGGATTAGGATGAGGAAGTGGGGAAAGTGGGTTGCCGAAATCAGGGAACCAAACAAGAGGTCTCGTATATGGCTTGGCTCTTACTCTTCCCCCGTCGCCGCAGCTCGTGCCTACGACACCGCCGTCTTTTACCTCAGAGGTCCTTCCGCCCGCCTTAATTTCCCCGATTCTATTTCCGAAAAAGACGTTGATCTTCACGATTTGTCTGCCGCTTCTATTCGAAAGAAAGCTACTGAGGTGGGTGCCAGAGTTGATGCTATTCAAAGTTCTGTTCATCATCGATCACCGGAATCGGATTCAACGCGAATTATCGAAAAGCCCGACTTGAACGAGTTTCCAAGCCCTGAAACCTCCGATGATAACTGA

Network for GWHGAAZE014119

Network category	Network	Top300 PCC genelist
Coexpression Positive	Network	Top300 PCC genelist
Coexpression Negative	Network	Top300 PCC genelist

Functional Module

Module ID	Function Annotation

Protein Structure

Pfam accession	Pfam name	Alignment start	Alignment end	E-value
PF00847.21	AP2	29	77	1.90E-11

Protein Sequence

Gene family

Gene family	subfamily
Transcription Factors Family	AP2/ERF-ERF

KEGG pathway

KO	Enzyme	pathway	mapID
--	--	--	--

Gene Ontology

GO term	Ontology	Name
GO:0006355	biological_process	regulation of transcription, DNA-templated
GO:0003700	molecular_function	DNA-binding transcription factor activity
GO:0003677	molecular_function	DNA binding

Expression pattern

Expression pattern detail

SRP	Sample	Description	TPM
SRP075780	SRR3591705	youngest leaf	4.658
	SRR3591706	second leaf	9.194
	SRR3591707	mature leaf	34.146
	SRR3591708	Shoot apex	9.420
	SRR3591709	Stem	33.464
	SRR3591710	White floral bud	56.248
	SRR3591711	White flower	77.204
	SRR3591712	Green floral bud	10.238
	SRR3591713	Yellow flower	56.457
SRP173429	SRR8316895	Juvenile bud stage	1.099
	SRR8316896	Juvenile bud stage	2.114
	SRR8316897	Juvenile bud stage	1.231
	SRR8316894	Third green stage	2.642
	SRR8316900	Third green stage	8.985
	SRR8316901	Third green stage	7.370
	SRR8316898	Complete white stage	29.863
	SRR8316899	Complete white stage	17.812
	SRR8316903	Complete white stage	40.153
	SRR8316902	Silver flowering stage	49.208
	SRR8316904	Silver flowering stage	44.680
	SRR8316905	Silver flowering stage	24.904
	SRR8316906	Gold flowering stage	68.270
	SRR8316907	Gold flowering stage	73.348
	SRR8316908	Gold flowering stage	62.260
SRP132670	SRR6706286	Control	14.038
	SRR6706287	Light intensity 50%	10.749
	SRR6706288	Light intensity 20%	9.149
CNP0000432	CNS0095592	Slightly white alabastrum(diploid) 1	6.651
	CNS0095593	Slightly white alabastrum(diploid) 2	5.991
	CNS0095594	Slightly white alabastrum(diploid) 3	7.788
	CNS0095595	Whole white alabastrum(diploid) 2	8.223
	CNS0095596	Whole white alabastrum(diploid) 3	6.202
	CNS0095597	Whole white alabastrum(diploid) 4	7.620
	CNS0095598	Silvery flower (diploied) 1	23.450
	CNS0095599	Silvery flower (diploied) 2	28.602
	CNS0095600	Silvery flower (diploied) 3	44.337
	CNS0095601	Golden flower (diploid) 1	42.447
	CNS0095602	Golden flower (diploid) 2	51.665
	CNS0095603	Golden flower (diploid) 3	45.460
	CNS0095604	Slightly white alabastrum(tetraploid) 1	3.792
	CNS0095605	Slightly white alabastrum(tetraploid) 2	6.698
	CNS0095606	Slightly white alabastrum(tetraploid) 3	4.549
	CNS0095607	Whole white alabastrum(tetraploid) 1	5.010
	CNS0095608	Whole white alabastrum(tetraploid) 2	5.928
	CNS0095609	Whole white alabastrum(tetraploid) 3	4.945
	CNS0095610	Silvery flower (diploied) 1	59.370
	CNS0095611	Silvery flower (diploied) 2	56.346
	CNS0095612	Silvery flower (diploied) 3	45.677
	CNS0095613	Golden flower (tetraploid) 1	80.797
	CNS0095614	Golden flower (tetraploid) 2	74.168
	CNS0095615	Golden flower (tetraploid) 3	138.359
CRA001975	CRR073297	Stem 1	10.385
	CRR073298	Stem 2	14.565
	CRR073299	Stem 3	17.173
	CRR073300	Leaf 1	21.829
	CRR073301	Leaf 2	24.955
	CRR073302	Leaf 3	20.238
	CRR073303	Juvenile bud 1	32.383
	CRR073304	Juvenile bud 2	37.072
	CRR073305	Juvenile bud 3	24.667
	CRR073306	Third green 1	108.196
	CRR073307	Third green 2	101.521
	CRR073308	Third green 3	89.188
	CRR073309	Second white 1	55.536
	CRR073310	Second white 2	61.812
	CRR073311	Second white 3	42.316
	CRR073312	Silver flowering 1	43.987
	CRR073313	Silver flowering 2	30.219
	CRR073314	Silver flowering 3	43.108
	CRR073315	Gold flowering 1	51.822
	CRR073316	Gold flowering 2	56.015
	CRR073317	Gold flowering 3	43.834
	CRR073318	Tawny withering 1	45.035
	CRR073319	Tawny withering 2	94.371
	CRR073320	Tawny withering 3	59.231