Gene detail

Detail information of GWHGAAZE014740

Functional Annotation

Database	Orthologs	E value	Annotation
Nr	XP_010259378.1	9.4931E-40	PREDICTED: transcription repressor MYB4-like [Nelumbo nucifera]
Swissprot	tr\|Q9S9K9\|MYB3_ARATH	5E-21	Transcription factor MYB3
trEMBL	tr\|D7TSS6\|D7TSS6_VITVI	2E-39	R2R3 MYB transcription factor {ECO:0000313\|EMBL:AIP98385.1}
TAIR10	AT4G38620.1	3E-14	myb domain protein 4

Location And Transcript Sequence (JBrowse)

Scaffold	Type	Start	End	Strand
GWHAAZE00000004	gene	17836629	17837987	-
GWHAAZE00000004	mRNA	17836629	17837987	-
GWHAAZE00000004	exon	17837952	17837987	-
GWHAAZE00000004	exon	17836629	17837084	-
GWHAAZE00000004	CDS	17837952	17837987	-
GWHAAZE00000004	CDS	17836629	17837084	-

Transcript Sequence
>GWHTAAZE014754 ATGAGGAAGCCATGCTGCGATAAAGTAAATAAACAGAAATTAACAAATTTTCTTTTTCTGACTGTTAGGTGGTCACTGATAGCGGGAAGGTTGCCCGGACGAACAGATAATGAGGTTAAAAACTACTGGAACTCTCACATGAAGAAAAAGCTCATAAGCATGGGAATCAACCCAAACAACCATCGGTTAAACCATAATCTTCCTCCTCGACAAAACCAACAAATCTCATCCGTTAAAACAACATCATCTGGGACCATCAACGCATCTGATGTATCGAAAACCTTTGGTGATAATGACAAACAGTCAGAAGCTGCAAGTTGCCTCGAAAATGAAACTTCAGTAAGTTCGCATCAAGCATTGGACCTTGAGCTAAGCGTTGCGATTCCTTCATCTTCACCTTCATTTGTTGAGAATAAGCGACAAAATATTGAGTCGAAAATGACCGAAGAAGTACAATGCGATCCATATCCTACTCTTCTTTTATTTAGATGA

Network for GWHGAAZE014740

Network category	Network	Top300 PCC genelist
Coexpression Positive	Network	Top300 PCC genelist
Coexpression Negative	Network	Top300 PCC genelist

Functional Module

Module ID	Function Annotation
CFinderModule0087	GO:0006820 anion transport GOslim:biological_process Transcription factor MYB-related family Transcription factor MYB-related

Protein Structure

Pfam accession	Pfam name	Alignment start	Alignment end	E-value
PF00249.32	Myb_DNA-binding	22	46	2.10E-06

Protein Sequence

Gene family

Gene family	subfamily
Transcription Factors Family	MYB-related

KEGG pathway

KO	Enzyme	pathway	mapID
--	--	--	--

Gene Ontology

GO term	Ontology	Name
GO:0003677	molecular_function	DNA binding

Expression pattern

Expression pattern detail

SRP	Sample	Description	TPM
SRP075780	SRR3591705	youngest leaf	1.349
	SRR3591706	second leaf	0.149
	SRR3591707	mature leaf	0.811
	SRR3591708	Shoot apex	0.477
	SRR3591709	Stem	2.927
	SRR3591710	White floral bud	96.536
	SRR3591711	White flower	75.177
	SRR3591712	Green floral bud	5.998
	SRR3591713	Yellow flower	31.691
SRP173429	SRR8316895	Juvenile bud stage	1.924
	SRR8316896	Juvenile bud stage	3.802
	SRR8316897	Juvenile bud stage	3.056
	SRR8316894	Third green stage	0.724
	SRR8316900	Third green stage	4.704
	SRR8316901	Third green stage	4.501
	SRR8316898	Complete white stage	6.257
	SRR8316899	Complete white stage	1.484
	SRR8316903	Complete white stage	11.546
	SRR8316902	Silver flowering stage	7.783
	SRR8316904	Silver flowering stage	11.801
	SRR8316905	Silver flowering stage	6.017
	SRR8316906	Gold flowering stage	8.432
	SRR8316907	Gold flowering stage	5.926
	SRR8316908	Gold flowering stage	8.134
SRP132670	SRR6706286	Control	4.102
	SRR6706287	Light intensity 50%	3.746
	SRR6706288	Light intensity 20%	3.577
CNP0000432	CNS0095592	Slightly white alabastrum(diploid) 1	2.960
	CNS0095593	Slightly white alabastrum(diploid) 2	5.103
	CNS0095594	Slightly white alabastrum(diploid) 3	7.755
	CNS0095595	Whole white alabastrum(diploid) 2	3.825
	CNS0095596	Whole white alabastrum(diploid) 3	5.326
	CNS0095597	Whole white alabastrum(diploid) 4	5.037
	CNS0095598	Silvery flower (diploied) 1	2.837
	CNS0095599	Silvery flower (diploied) 2	3.414
	CNS0095600	Silvery flower (diploied) 3	11.356
	CNS0095601	Golden flower (diploid) 1	3.906
	CNS0095602	Golden flower (diploid) 2	5.563
	CNS0095603	Golden flower (diploid) 3	3.633
	CNS0095604	Slightly white alabastrum(tetraploid) 1	5.012
	CNS0095605	Slightly white alabastrum(tetraploid) 2	10.237
	CNS0095606	Slightly white alabastrum(tetraploid) 3	3.742
	CNS0095607	Whole white alabastrum(tetraploid) 1	11.496
	CNS0095608	Whole white alabastrum(tetraploid) 2	9.522
	CNS0095609	Whole white alabastrum(tetraploid) 3	9.159
	CNS0095610	Silvery flower (diploied) 1	22.272
	CNS0095611	Silvery flower (diploied) 2	28.080
	CNS0095612	Silvery flower (diploied) 3	68.447
	CNS0095613	Golden flower (tetraploid) 1	5.765
	CNS0095614	Golden flower (tetraploid) 2	16.799
	CNS0095615	Golden flower (tetraploid) 3	12.750
CRA001975	CRR073297	Stem 1	2.197
	CRR073298	Stem 2	2.512
	CRR073299	Stem 3	3.336
	CRR073300	Leaf 1	2.770
	CRR073301	Leaf 2	2.130
	CRR073302	Leaf 3	2.165
	CRR073303	Juvenile bud 1	0.337
	CRR073304	Juvenile bud 2	3.517
	CRR073305	Juvenile bud 3	0.494
	CRR073306	Third green 1	28.623
	CRR073307	Third green 2	22.232
	CRR073308	Third green 3	33.247
	CRR073309	Second white 1	14.957
	CRR073310	Second white 2	12.005
	CRR073311	Second white 3	7.454
	CRR073312	Silver flowering 1	2.853
	CRR073313	Silver flowering 2	1.049
	CRR073314	Silver flowering 3	0.987
	CRR073315	Gold flowering 1	0.000
	CRR073316	Gold flowering 2	0.000
	CRR073317	Gold flowering 3	0.000
	CRR073318	Tawny withering 1	0.200
	CRR073319	Tawny withering 2	0.382
	CRR073320	Tawny withering 3	0.000