Gene detail

Detail information of GWHGAAZE015171

Functional Annotation

Database	Orthologs	E value	Annotation
Nr	BAE79547.1	7.2581E-121	1-deoxyxylulose 5-phosphate synthase [Chrysanthemum x morifolium]
Swissprot	tr\|Q6YU51\|DXS2_ORYSJ	9E-116	Probable 1-deoxy-D-xylulose-5-phosphate synthase 2, chloroplastic (Precursor)
trEMBL	tr\|Q2HXK2\|Q2HXK2_CHRMO	3E-121	1-deoxyxylulose 5-phosphate synthase {ECO:0000313\|EMBL:BAE79547.1}
TAIR10	AT4G15560.1	8E-81	Deoxyxylulose-5-phosphate synthase

Location And Transcript Sequence (JBrowse)

Scaffold	Type	Start	End	Strand
GWHAAZE00000004	gene	26900970	26901899	+
GWHAAZE00000004	mRNA	26900970	26901899	+
GWHAAZE00000004	exon	26900970	26901249	+
GWHAAZE00000004	exon	26901586	26901899	+
GWHAAZE00000004	CDS	26900970	26901249	+
GWHAAZE00000004	CDS	26901586	26901899	+

Transcript Sequence
>GWHTAAZE015187 ATGAAGAGCATCACGAAGCAAATTGGACCCCAAGCACATGAAGTTGCAGCCAAAGTAGACAAATACGGCAGGGGAATGATTAGTGCTACCGGCTCTACTCTCTTTGAGGAGCTCAGATTGTACTACATAGGTCCAGTAGATGGGCACAATGTGGAAGATTTGGTTGCCATTTTCGAGAAAGTTAAGTCTATGCCAGCACCAGGGCTAGTTTTGATCCACATTGTGACTGAGACAGGCAAAGGCTATCCCCCAGCTGAGGCAGCAGCCGATAAAATGCATGGGGTTGTGAAGTTTGATGTGCAGACAGGGAAGCAATATAAGCCTAAAGCTGCTACACTTTCATATACTCAATATTTTGCCGAAGCGCTGATACAAGAAGCTGAGGAAGATAACAAGATTGTAGCAATCCATGCAGCCATGGGTGGTGGGACCGGCCTCAATTATTTCCAAAAGAGGTTCCCAGATCGATGTTTCGACGTGGGCATTACCGAGCAACACGCTGTTACTTTCGCTACTGGCTTAGCCACAGAGGGTCTCAAGCCATTTTGTGCTATCTATTCCTCTTTCCTGCAAAGAGGCTATGAACAGGTATAG

Network for GWHGAAZE015171

Network category	Network	Top300 PCC genelist
Coexpression Positive	Network	Top300 PCC genelist
Coexpression Negative	Network	Top300 PCC genelist

Functional Module

Module ID	Function Annotation

Protein Structure

Pfam accession	Pfam name	Alignment start	Alignment end	E-value
PF13292.7	DXP_synthase_N	2	76	2.20E-13
PF02779.25	Transket_pyr	113	193	1.60E-19

Protein Sequence

Gene family

Gene family	subfamily
--	--

KEGG pathway

KO	Enzyme	pathway	mapID
K01662	dxs	Metabolic pathways	map01100
		Biosynthesis of secondary metabolites	map01110
		Thiamine metabolism	map00730
		Terpenoid backbone biosynthesis	map00900

Gene Ontology

GO term	Ontology	Name
GO:0016114	biological_process	terpenoid biosynthetic process
GO:0008661	molecular_function	1-deoxy-D-xylulose-5-phosphate synthase activity

Expression pattern

Expression pattern detail

SRP	Sample	Description	TPM
SRP075780	SRR3591705	youngest leaf	0.053
	SRR3591706	second leaf	0.701
	SRR3591707	mature leaf	0.232
	SRR3591708	Shoot apex	0.455
	SRR3591709	Stem	0.442
	SRR3591710	White floral bud	82.897
	SRR3591711	White flower	122.913
	SRR3591712	Green floral bud	10.856
	SRR3591713	Yellow flower	54.696
SRP173429	SRR8316895	Juvenile bud stage	0.037
	SRR8316896	Juvenile bud stage	0.112
	SRR8316897	Juvenile bud stage	0.090
	SRR8316894	Third green stage	0.090
	SRR8316900	Third green stage	0.217
	SRR8316901	Third green stage	0.338
	SRR8316898	Complete white stage	3.509
	SRR8316899	Complete white stage	1.289
	SRR8316903	Complete white stage	4.481
	SRR8316902	Silver flowering stage	9.739
	SRR8316904	Silver flowering stage	13.825
	SRR8316905	Silver flowering stage	6.250
	SRR8316906	Gold flowering stage	13.670
	SRR8316907	Gold flowering stage	10.453
	SRR8316908	Gold flowering stage	11.680
SRP132670	SRR6706286	Control	0.731
	SRR6706287	Light intensity 50%	0.933
	SRR6706288	Light intensity 20%	0.895
CNP0000432	CNS0095592	Slightly white alabastrum(diploid) 1	0.069
	CNS0095593	Slightly white alabastrum(diploid) 2	0.140
	CNS0095594	Slightly white alabastrum(diploid) 3	0.068
	CNS0095595	Whole white alabastrum(diploid) 2	0.026
	CNS0095596	Whole white alabastrum(diploid) 3	0.000
	CNS0095597	Whole white alabastrum(diploid) 4	0.254
	CNS0095598	Silvery flower (diploied) 1	0.451
	CNS0095599	Silvery flower (diploied) 2	0.288
	CNS0095600	Silvery flower (diploied) 3	8.832
	CNS0095601	Golden flower (diploid) 1	0.301
	CNS0095602	Golden flower (diploid) 2	3.233
	CNS0095603	Golden flower (diploid) 3	2.928
	CNS0095604	Slightly white alabastrum(tetraploid) 1	0.058
	CNS0095605	Slightly white alabastrum(tetraploid) 2	0.030
	CNS0095606	Slightly white alabastrum(tetraploid) 3	0.330
	CNS0095607	Whole white alabastrum(tetraploid) 1	0.109
	CNS0095608	Whole white alabastrum(tetraploid) 2	0.449
	CNS0095609	Whole white alabastrum(tetraploid) 3	0.398
	CNS0095610	Silvery flower (diploied) 1	2.760
	CNS0095611	Silvery flower (diploied) 2	4.044
	CNS0095612	Silvery flower (diploied) 3	36.164
	CNS0095613	Golden flower (tetraploid) 1	2.830
	CNS0095614	Golden flower (tetraploid) 2	1.672
	CNS0095615	Golden flower (tetraploid) 3	7.184
CRA001975	CRR073297	Stem 1	0.222
	CRR073298	Stem 2	0.275
	CRR073299	Stem 3	0.070
	CRR073300	Leaf 1	0.586
	CRR073301	Leaf 2	0.576
	CRR073302	Leaf 3	0.279
	CRR073303	Juvenile bud 1	0.749
	CRR073304	Juvenile bud 2	1.213
	CRR073305	Juvenile bud 3	0.678
	CRR073306	Third green 1	28.089
	CRR073307	Third green 2	9.887
	CRR073308	Third green 3	17.176
	CRR073309	Second white 1	24.922
	CRR073310	Second white 2	34.162
	CRR073311	Second white 3	35.578
	CRR073312	Silver flowering 1	31.183
	CRR073313	Silver flowering 2	40.473
	CRR073314	Silver flowering 3	26.291
	CRR073315	Gold flowering 1	0.089
	CRR073316	Gold flowering 2	0.000
	CRR073317	Gold flowering 3	0.000
	CRR073318	Tawny withering 1	0.000
	CRR073319	Tawny withering 2	0.037
	CRR073320	Tawny withering 3	0.235