Gene detail

Detail information of GWHGAAZE015325

Functional Annotation

Database	Orthologs	E value	Annotation
Nr	XP_006371951.1	3.9487E-130	hypothetical protein POPTR_0018s06630g [Populus trichocarpa]
Swissprot	tr\|Q9C5D7\|CAMT3_ARATH	6E-116	Probable caffeoyl-CoA O-methyltransferase At4g26220
trEMBL	tr\|B9N5I7\|B9N5I7_POPTR	1E-130	Uncharacterized protein {ECO:0000313\|EMBL:ERP49748.1}
TAIR10	AT4G26220.1	1E-91	S-adenosyl-L-methionine-dependent methyltransferases superfamily protein

Location And Transcript Sequence (JBrowse)

Scaffold	Type	Start	End	Strand
GWHAAZE00000004	gene	31571305	31575186	+
GWHAAZE00000004	mRNA	31571305	31575186	+
GWHAAZE00000004	exon	31571305	31571373	+
GWHAAZE00000004	exon	31571791	31571870	+
GWHAAZE00000004	exon	31572670	31572814	+
GWHAAZE00000004	exon	31573181	31573312	+
GWHAAZE00000004	exon	31574875	31575186	+
GWHAAZE00000004	CDS	31571305	31571373	+
GWHAAZE00000004	CDS	31571791	31571870	+
GWHAAZE00000004	CDS	31572670	31572814	+
GWHAAZE00000004	CDS	31573181	31573312	+
GWHAAZE00000004	CDS	31574875	31575186	+

Transcript Sequence
>GWHTAAZE015341 ATGGAGAATGGAAAAAAGAAAGCACCAGCTCCTTCTAAAGCATTACTACAAAGCGAAGAGTTGTATCAGTATATATTGGAGACTAGTGTGTATCCACGTGAACCAGAACCTCTCAAGGAGCTAAGGGCTGCAGCTGCAAACCATCCTCTGGCTTTGATGGGTACAGCACCAGATGCAGGGCAAATGATGGCCATGCTACTGAAGCTAGTTGATGCCAAAAAGACTATCGAAATTGGAGTTTTTACTGGATATTCCTTGCTCCTCACTGCCCTTACTATTCCTGATGATGGCAAGATTACGGCAGTAGATGTGAATAGAGAGTCATATGAGATAGGGTTGCCGATTATCAGAAAAGCCGGCGTGGAACATAAAATCGACTTTTGTCACTCTGAGGCTTTACCGGTTCTTGACAAGCTCTTGGAAGATCATGAGAATGAGGGAAGTTTTGACTTTGCTTTTGTCGATGCTGATAAGATTAGTTTCTTGAAGTATCATGAGAGATTGATGAAATTATTAAAGGTTGGAGGGATAATTGTGTATGATAACACACTTTGGGGAGGAACAGTGGCAATGGCGGAGGGGACGGTTACAGAGCAGATGAGCGAGCTCAAGCATTGGATCATAGAGGGCAGACATTGGACCATAGAGTTCAACAAGTCACTAGCTGCCGATCCTCGCATTCAAATTTCTCACGCTCCATTGGGAGATGGAATCACTATCTGTAGGCGTATCTATTGA

Network for GWHGAAZE015325

Network category	Network	Top300 PCC genelist
Coexpression Positive	Network	Top300 PCC genelist
Coexpression Negative	Network	Top300 PCC genelist

Functional Module

Module ID	Function Annotation

Protein Structure

Pfam accession	Pfam name	Alignment start	Alignment end	E-value
PF01596.18	Methyltransf_3	27	244	1.30E-78

Protein Sequence

Gene family

Gene family	subfamily
--	--

KEGG pathway

KO	Enzyme	pathway	mapID
K00588	E2.1.1.104	Metabolic pathways	map01100
		Biosynthesis of secondary metabolites	map01110
		Phenylpropanoid biosynthesis	map00940
		Stilbenoid, diarylheptanoid and gingerol biosynthesis	map00945
		Flavonoid biosynthesis	map00941

Gene Ontology

GO term	Ontology	Name
GO:0008171	molecular_function	O-methyltransferase activity

Expression pattern

Expression pattern detail

SRP	Sample	Description	TPM
SRP075780	SRR3591705	youngest leaf	39.815
	SRR3591706	second leaf	2.034
	SRR3591707	mature leaf	0.178
	SRR3591708	Shoot apex	5.176
	SRR3591709	Stem	10.734
	SRR3591710	White floral bud	0.592
	SRR3591711	White flower	0.000
	SRR3591712	Green floral bud	10.261
	SRR3591713	Yellow flower	0.000
SRP173429	SRR8316895	Juvenile bud stage	1.243
	SRR8316896	Juvenile bud stage	1.921
	SRR8316897	Juvenile bud stage	0.353
	SRR8316894	Third green stage	0.765
	SRR8316900	Third green stage	2.635
	SRR8316901	Third green stage	3.304
	SRR8316898	Complete white stage	0.091
	SRR8316899	Complete white stage	3.362
	SRR8316903	Complete white stage	0.880
	SRR8316902	Silver flowering stage	0.000
	SRR8316904	Silver flowering stage	0.041
	SRR8316905	Silver flowering stage	0.097
	SRR8316906	Gold flowering stage	0.000
	SRR8316907	Gold flowering stage	0.047
	SRR8316908	Gold flowering stage	0.062
SRP132670	SRR6706286	Control	2.195
	SRR6706287	Light intensity 50%	1.618
	SRR6706288	Light intensity 20%	1.461
CNP0000432	CNS0095592	Slightly white alabastrum(diploid) 1	0.508
	CNS0095593	Slightly white alabastrum(diploid) 2	0.848
	CNS0095594	Slightly white alabastrum(diploid) 3	2.091
	CNS0095595	Whole white alabastrum(diploid) 2	1.370
	CNS0095596	Whole white alabastrum(diploid) 3	3.613
	CNS0095597	Whole white alabastrum(diploid) 4	0.571
	CNS0095598	Silvery flower (diploied) 1	0.010
	CNS0095599	Silvery flower (diploied) 2	0.305
	CNS0095600	Silvery flower (diploied) 3	0.247
	CNS0095601	Golden flower (diploid) 1	0.248
	CNS0095602	Golden flower (diploid) 2	0.049
	CNS0095603	Golden flower (diploid) 3	0.085
	CNS0095604	Slightly white alabastrum(tetraploid) 1	0.908
	CNS0095605	Slightly white alabastrum(tetraploid) 2	0.880
	CNS0095606	Slightly white alabastrum(tetraploid) 3	5.332
	CNS0095607	Whole white alabastrum(tetraploid) 1	3.061
	CNS0095608	Whole white alabastrum(tetraploid) 2	3.303
	CNS0095609	Whole white alabastrum(tetraploid) 3	2.926
	CNS0095610	Silvery flower (diploied) 1	0.081
	CNS0095611	Silvery flower (diploied) 2	0.368
	CNS0095612	Silvery flower (diploied) 3	0.140
	CNS0095613	Golden flower (tetraploid) 1	0.063
	CNS0095614	Golden flower (tetraploid) 2	0.085
	CNS0095615	Golden flower (tetraploid) 3	0.020
CRA001975	CRR073297	Stem 1	1.649
	CRR073298	Stem 2	1.309
	CRR073299	Stem 3	3.700
	CRR073300	Leaf 1	1.921
	CRR073301	Leaf 2	1.335
	CRR073302	Leaf 3	1.443
	CRR073303	Juvenile bud 1	0.000
	CRR073304	Juvenile bud 2	0.051
	CRR073305	Juvenile bud 3	0.739
	CRR073306	Third green 1	0.171
	CRR073307	Third green 2	0.018
	CRR073308	Third green 3	0.636
	CRR073309	Second white 1	0.056
	CRR073310	Second white 2	0.000
	CRR073311	Second white 3	0.087
	CRR073312	Silver flowering 1	0.064
	CRR073313	Silver flowering 2	0.000
	CRR073314	Silver flowering 3	0.000
	CRR073315	Gold flowering 1	0.000
	CRR073316	Gold flowering 2	0.000
	CRR073317	Gold flowering 3	0.000
	CRR073318	Tawny withering 1	2.441
	CRR073319	Tawny withering 2	0.358
	CRR073320	Tawny withering 3	5.792