Gene detail

Detail information of GWHGAAZE015856

Functional Annotation

Database	Orthologs	E value	Annotation
Nr	XP_002271836.1	3.9168E-99	PREDICTED: uncharacterized protein LOC100241175 [Vitis vinifera]
trEMBL	tr\|D7U335\|D7U335_VITVI	2E-98	Putative uncharacterized protein {ECO:0000313\|EMBL:CBI37152.3}
TAIR10	AT5G07900.1	8E-69	Mitochondrial transcription termination factor family protein

Location And Transcript Sequence (JBrowse)

Scaffold	Type	Start	End	Strand
GWHAAZE00000004	gene	60588541	60589422	+
GWHAAZE00000004	mRNA	60588541	60589422	+
GWHAAZE00000004	exon	60588541	60589422	+
GWHAAZE00000004	CDS	60588541	60589422	+

Transcript Sequence
>GWHTAAZE015872 ATGGTTAGAATACGCCCCAGGATTCTTTTTTCAGATCCCAAGAAAACCCTGATTCCCAAGCTGGAGTTCTTTCGCTCCATAGGGTTATCAAGAACCGATATGCCAAGAATTCTCTCGTTGAATCCGTCTTTGTTAGGGAGGAGTTTAGAGAATCAGTTGATTCCTTGTCATAACTTCCTAAAAAATGTACTAATTCTTGATGAAAATGTTGTTAAGATGTTAAAGCAGAATTCGAGAATACTTCTTCATGATTTTGAGAAGAATATTGGTCCGAATATTTGTTCATTGAGTGGGGTTGGGGTTCCTAAATCGCTAATTTCGTTCATGTTGTTTCAGTTTCCGTGTGTTGCTTATCAAAATCACGAGAAGTTTAAGAAAGCTGTAGAGGAAGTTATTGAAATGGGATTTAATCCGTTGAGGACTATGTTTGTTCAAGCAGTTCAAGTGATTTGTGAATTGACTAAAATGACATGGGATCGTAAGTGGGCGGCCTTTAGGAGGTGGGGTTTGTCCGATGACAAGATTCTATTGGCGTTTAGATCGCATCCGTTGTGTATGAATTTGTCCGAGGAGAAAATTATAAGGGAAATGGATTTTCTTGTGAACAAAATGGGTTGGGAGGCTGTGAAAGTTGCTAGGTGTCCAGCCGTACTTTTTTACAATTTGGAAAATAGGATCATTCCGAGGTGTAGAGTGATAAAAGTTTTGATATCGGAGGGAATTTTGAAGAAAGATATGAGCTTGGGTACCTTTTTGATGCCTTCGGAAAATCAATTCTTGAAAAGGTTTGTGAGCAACCATGAAGACAAAGTTCCTGAGCTGCTAGATGTTTATCGAGGGAAGACGGTTCGTTTGAAAACAGGACTTCGATCCAAGGATTGA

Network for GWHGAAZE015856

Network category	Network	Top300 PCC genelist
Coexpression Positive	Network	Top300 PCC genelist
Coexpression Negative	Network	Top300 PCC genelist

Functional Module

Module ID	Function Annotation

Protein Structure

Pfam accession	Pfam name	Alignment start	Alignment end	E-value
PF02536.15	mTERF	5	134	4.60E-15
PF02536.15	mTERF	59	260	4.20E-26

Protein Sequence

Gene family

Gene family	subfamily
Transcription Factors Family	mTERF

KEGG pathway

KO	Enzyme	pathway	mapID
--	--	--	--

Gene Ontology

GO term	Ontology	Name
GO:0006355	biological_process	regulation of transcription, DNA-templated
GO:0003690	molecular_function	double-stranded DNA binding

Expression pattern

Expression pattern detail

SRP	Sample	Description	TPM
SRP075780	SRR3591705	youngest leaf	9.597
	SRR3591706	second leaf	4.369
	SRR3591707	mature leaf	6.711
	SRR3591708	Shoot apex	11.571
	SRR3591709	Stem	6.332
	SRR3591710	White floral bud	4.008
	SRR3591711	White flower	6.104
	SRR3591712	Green floral bud	8.813
	SRR3591713	Yellow flower	4.409
SRP173429	SRR8316895	Juvenile bud stage	2.754
	SRR8316896	Juvenile bud stage	2.179
	SRR8316897	Juvenile bud stage	2.200
	SRR8316894	Third green stage	1.448
	SRR8316900	Third green stage	5.163
	SRR8316901	Third green stage	3.835
	SRR8316898	Complete white stage	0.903
	SRR8316899	Complete white stage	6.086
	SRR8316903	Complete white stage	1.184
	SRR8316902	Silver flowering stage	1.002
	SRR8316904	Silver flowering stage	1.609
	SRR8316905	Silver flowering stage	0.818
	SRR8316906	Gold flowering stage	2.725
	SRR8316907	Gold flowering stage	2.190
	SRR8316908	Gold flowering stage	3.815
SRP132670	SRR6706286	Control	3.579
	SRR6706287	Light intensity 50%	3.559
	SRR6706288	Light intensity 20%	4.647
CNP0000432	CNS0095592	Slightly white alabastrum(diploid) 1	3.408
	CNS0095593	Slightly white alabastrum(diploid) 2	3.690
	CNS0095594	Slightly white alabastrum(diploid) 3	1.358
	CNS0095595	Whole white alabastrum(diploid) 2	3.005
	CNS0095596	Whole white alabastrum(diploid) 3	4.242
	CNS0095597	Whole white alabastrum(diploid) 4	3.472
	CNS0095598	Silvery flower (diploied) 1	2.714
	CNS0095599	Silvery flower (diploied) 2	3.181
	CNS0095600	Silvery flower (diploied) 3	1.770
	CNS0095601	Golden flower (diploid) 1	1.409
	CNS0095602	Golden flower (diploid) 2	1.767
	CNS0095603	Golden flower (diploid) 3	1.388
	CNS0095604	Slightly white alabastrum(tetraploid) 1	4.259
	CNS0095605	Slightly white alabastrum(tetraploid) 2	2.776
	CNS0095606	Slightly white alabastrum(tetraploid) 3	5.585
	CNS0095607	Whole white alabastrum(tetraploid) 1	1.901
	CNS0095608	Whole white alabastrum(tetraploid) 2	3.354
	CNS0095609	Whole white alabastrum(tetraploid) 3	4.267
	CNS0095610	Silvery flower (diploied) 1	1.436
	CNS0095611	Silvery flower (diploied) 2	1.843
	CNS0095612	Silvery flower (diploied) 3	1.101
	CNS0095613	Golden flower (tetraploid) 1	0.689
	CNS0095614	Golden flower (tetraploid) 2	1.408
	CNS0095615	Golden flower (tetraploid) 3	0.489
CRA001975	CRR073297	Stem 1	2.348
	CRR073298	Stem 2	1.662
	CRR073299	Stem 3	1.706
	CRR073300	Leaf 1	1.430
	CRR073301	Leaf 2	1.314
	CRR073302	Leaf 3	1.147
	CRR073303	Juvenile bud 1	1.890
	CRR073304	Juvenile bud 2	1.384
	CRR073305	Juvenile bud 3	1.500
	CRR073306	Third green 1	0.000
	CRR073307	Third green 2	0.000
	CRR073308	Third green 3	0.810
	CRR073309	Second white 1	0.310
	CRR073310	Second white 2	0.159
	CRR073311	Second white 3	0.241
	CRR073312	Silver flowering 1	0.222
	CRR073313	Silver flowering 2	0.383
	CRR073314	Silver flowering 3	0.000
	CRR073315	Gold flowering 1	2.207
	CRR073316	Gold flowering 2	2.152
	CRR073317	Gold flowering 3	1.520
	CRR073318	Tawny withering 1	1.041
	CRR073319	Tawny withering 2	1.058
	CRR073320	Tawny withering 3	1.960