Gene detail

Detail information of GWHGAAZE016408

Functional Annotation

Database	Orthologs	E value	Annotation
Nr	XP_011074364.1	2.66295E-49	PREDICTED: zinc finger protein ZAT10-like [Sesamum indicum]
Swissprot	tr\|Q96289\|ZAT10_ARATH	1E-37	Zinc finger protein ZAT10
trEMBL	tr\|S8BTR8\|S8BTR8_9LAMI	3E-49	Cys2/his2-type zinc finger transcription factor {ECO:0000313\|EMBL:EPS57985.1}
TAIR10	AT1G27730.1	2E-28	salt tolerance zinc finger

Location And Transcript Sequence (JBrowse)

Scaffold	Type	Start	End	Strand
GWHAAZE00000004	gene	75969576	75970034	+
GWHAAZE00000004	mRNA	75969576	75970034	+
GWHAAZE00000004	exon	75969576	75970034	+
GWHAAZE00000004	CDS	75969576	75970034	+

Transcript Sequence
>GWHTAAZE016428 ATGCTCGCTCGCGGCGTCACCGGCGCCGTCATTCCTCCTCCTCCTGCTCCGGTGTCGGCAACCGATTCGAAGATCCACAAGTGTAGTGTCTGCGATAAGGTTTTCGGATCTTACCAAGCCCTAGGCGGACACAAAGCAAGTCACCGGAAACATGCCGGAGCCGACGACAGATCCATCACCACCACCTCTGCCGCCGTTACTACGGCCACGACCGGCGGTGGAAGGATTCACGAGTGCTCGATCTGCCATAAGTGTTTTCCGAGCGGACAGGCGTTGGGAGGTCACAAAAGACGCCACTACGATGGCGGCGCGTCGTCGTCGTCATCGGAGGCCCGTTATTTCGATCTGAACCTGCCGGCCTTGCCGGAGTTTTGGAGTGTTTGTGACGAGGAGGTGGAAAGCCCTCACCCGGCCAAAAAGTCACGGTTATCACTTCCGGCCAAACTCGAAATGATTTAG

Network for GWHGAAZE016408

Network category	Network	Top300 PCC genelist
Coexpression Positive	Network	Top300 PCC genelist
Coexpression Negative	Network	Top300 PCC genelist

Functional Module

Module ID	Function Annotation

Protein Structure

Pfam accession	Pfam name	Alignment start	Alignment end	E-value
PF13912.7	zf-C2H2_6	26	50	1.40E-13
PF13912.7	zf-C2H2_6	77	101	2.80E-11

Protein Sequence

Gene family

Gene family	subfamily
Transcription Factors Family	C2H2

KEGG pathway

KO	Enzyme	pathway	mapID
--	--	--	--

Gene Ontology

GO term	Ontology	Name
GO:0003676	molecular_function	nucleic acid binding

Expression pattern

Expression pattern detail

SRP	Sample	Description	TPM
SRP075780	SRR3591705	youngest leaf	132.861
	SRR3591706	second leaf	22.840
	SRR3591707	mature leaf	23.545
	SRR3591708	Shoot apex	65.756
	SRR3591709	Stem	195.121
	SRR3591710	White floral bud	64.306
	SRR3591711	White flower	131.393
	SRR3591712	Green floral bud	23.375
	SRR3591713	Yellow flower	81.710
SRP173429	SRR8316895	Juvenile bud stage	193.571
	SRR8316896	Juvenile bud stage	142.103
	SRR8316897	Juvenile bud stage	157.747
	SRR8316894	Third green stage	35.194
	SRR8316900	Third green stage	37.452
	SRR8316901	Third green stage	101.556
	SRR8316898	Complete white stage	1.610
	SRR8316899	Complete white stage	191.331
	SRR8316903	Complete white stage	4.926
	SRR8316902	Silver flowering stage	12.260
	SRR8316904	Silver flowering stage	7.671
	SRR8316905	Silver flowering stage	12.030
	SRR8316906	Gold flowering stage	63.235
	SRR8316907	Gold flowering stage	40.335
	SRR8316908	Gold flowering stage	46.838
SRP132670	SRR6706286	Control	16.977
	SRR6706287	Light intensity 50%	16.998
	SRR6706288	Light intensity 20%	10.913
CNP0000432	CNS0095592	Slightly white alabastrum(diploid) 1	143.642
	CNS0095593	Slightly white alabastrum(diploid) 2	223.189
	CNS0095594	Slightly white alabastrum(diploid) 3	215.508
	CNS0095595	Whole white alabastrum(diploid) 2	134.379
	CNS0095596	Whole white alabastrum(diploid) 3	19.564
	CNS0095597	Whole white alabastrum(diploid) 4	106.109
	CNS0095598	Silvery flower (diploied) 1	603.238
	CNS0095599	Silvery flower (diploied) 2	494.280
	CNS0095600	Silvery flower (diploied) 3	180.097
	CNS0095601	Golden flower (diploid) 1	529.532
	CNS0095602	Golden flower (diploid) 2	310.153
	CNS0095603	Golden flower (diploid) 3	297.065
	CNS0095604	Slightly white alabastrum(tetraploid) 1	1.386
	CNS0095605	Slightly white alabastrum(tetraploid) 2	1.601
	CNS0095606	Slightly white alabastrum(tetraploid) 3	3.650
	CNS0095607	Whole white alabastrum(tetraploid) 1	1.727
	CNS0095608	Whole white alabastrum(tetraploid) 2	2.050
	CNS0095609	Whole white alabastrum(tetraploid) 3	0.945
	CNS0095610	Silvery flower (diploied) 1	63.689
	CNS0095611	Silvery flower (diploied) 2	39.845
	CNS0095612	Silvery flower (diploied) 3	24.297
	CNS0095613	Golden flower (tetraploid) 1	58.039
	CNS0095614	Golden flower (tetraploid) 2	60.397
	CNS0095615	Golden flower (tetraploid) 3	100.873
CRA001975	CRR073297	Stem 1	69.306
	CRR073298	Stem 2	91.905
	CRR073299	Stem 3	111.896
	CRR073300	Leaf 1	146.272
	CRR073301	Leaf 2	256.555
	CRR073302	Leaf 3	131.786
	CRR073303	Juvenile bud 1	128.464
	CRR073304	Juvenile bud 2	170.043
	CRR073305	Juvenile bud 3	306.688
	CRR073306	Third green 1	76.924
	CRR073307	Third green 2	87.672
	CRR073308	Third green 3	55.177
	CRR073309	Second white 1	67.563
	CRR073310	Second white 2	66.991
	CRR073311	Second white 3	63.166
	CRR073312	Silver flowering 1	177.197
	CRR073313	Silver flowering 2	194.468
	CRR073314	Silver flowering 3	127.905
	CRR073315	Gold flowering 1	108.136
	CRR073316	Gold flowering 2	161.564
	CRR073317	Gold flowering 3	168.655
	CRR073318	Tawny withering 1	66.108
	CRR073319	Tawny withering 2	196.526
	CRR073320	Tawny withering 3	79.277