Gene detail

Detail information of GWHGAAZE017787

Functional Annotation

Database	Orthologs	E value	Annotation
Nr	XP_010258443.1	9.66335E-95	PREDICTED: vesicle transport v-SNARE 13-like [Nelumbo nucifera]
Swissprot	tr\|Q9LVP9\|VTI13_ARATH	1E-79	Vesicle transport v-SNARE 13
trEMBL	tr\|M0TD18\|M0TD18_MUSAM	1E-93	Uncharacterized protein {ECO:0000313\|EnsemblPlants:GSMUA_Achr6P35750_001}
TAIR10	AT5G39510.1	4E-58	Vesicle transport v-SNARE family protein

Location And Transcript Sequence (JBrowse)

Scaffold	Type	Start	End	Strand
GWHAAZE00000005	gene	10803652	10805193	+
GWHAAZE00000005	mRNA	10803652	10805193	+
GWHAAZE00000005	exon	10803652	10803825	+
GWHAAZE00000005	exon	10803931	10804057	+
GWHAAZE00000005	exon	10804615	10804790	+
GWHAAZE00000005	exon	10805041	10805193	+
GWHAAZE00000005	CDS	10803652	10803825	+
GWHAAZE00000005	CDS	10803931	10804057	+
GWHAAZE00000005	CDS	10804615	10804790	+
GWHAAZE00000005	CDS	10805041	10805193	+

Transcript Sequence
>GWHTAAZE017807 ATGCCCAATAATTGTTTTCTGTTTTTAGATCTCTATCAGAGCTCTAAACTGTTCACTTCTTTTTGTCATTACGACTTTCTGATCAGTGTTGCTCGAATACATTCACGACTTGCAGAGCGGAAGAAACAGAAAGTTTCTGAAATCAAAGCTGGATTGGACGATGCCGAGGCTTTGATTCGTAAAATGGACCTTGAGGCTAGGAGTTTGCCTTCAAGTGTAAAGGCTGTGTTACTTGCCAAGTTACGAGAATACAAAAATGATCTTAACAATTTGAAAAGCCAAGTCAAAAGAATCACATCTGTGCAGGTGACTCAAGATCAAAGAGGAAGATTATTGATGTCAACCGAGAGATTAAACCAGTCCACTGATAGAATCAAGGAAAGCAGAAGAACTATGCTAGAAACTGAGGATCTTGGTGTTTCCGTTCTTCATGATCTACATCAACAACGCCAGTCTCTCCTACATGCCCATAACACCCTTCATGGGGTGGATGACAATATTGGGAGGAGCAAGAAGATACTGACTGCAATGTCAAGAAGGATGAACAGGAACAAATGGATAATTAGTTCATTTATTGCAGCCCTGGTTCTTGCTATCCTTTTGATCCTTTATTTTAAGTTTACCCATTAG

Network for GWHGAAZE017787

Network category	Network	Top300 PCC genelist
Coexpression Positive	Network	Top300 PCC genelist
Coexpression Negative	Network	Top300 PCC genelist

Functional Module

Module ID	Function Annotation

Protein Structure

Pfam accession	Pfam name	Alignment start	Alignment end	E-value
PF05008.16	V-SNARE	31	97	4.80E-19
PF12352.9	V-SNARE_C	116	181	5.80E-23

Protein Sequence

Gene family

Gene family	subfamily
--	--

KEGG pathway

KO	Enzyme	pathway	mapID
K08493	VTI1	SNARE interactions in vesicular transport	map04130
K08493	VTI1	Autophagy - yeast	map04138

Gene Ontology

GO term	Ontology	Name
GO:0016192	biological_process	vesicle-mediated transport
GO:0006886	biological_process	intracellular protein transport
GO:0016020	cellular_component	membrane

Expression pattern

Expression pattern detail

SRP	Sample	Description	TPM
SRP075780	SRR3591705	youngest leaf	90.080
	SRR3591706	second leaf	13.412
	SRR3591707	mature leaf	12.205
	SRR3591708	Shoot apex	21.376
	SRR3591709	Stem	53.035
	SRR3591710	White floral bud	21.150
	SRR3591711	White flower	21.376
	SRR3591712	Green floral bud	34.331
	SRR3591713	Yellow flower	17.927
SRP173429	SRR8316895	Juvenile bud stage	78.990
	SRR8316896	Juvenile bud stage	82.490
	SRR8316897	Juvenile bud stage	131.140
	SRR8316894	Third green stage	21.823
	SRR8316900	Third green stage	48.690
	SRR8316901	Third green stage	63.896
	SRR8316898	Complete white stage	9.609
	SRR8316899	Complete white stage	121.349
	SRR8316903	Complete white stage	12.087
	SRR8316902	Silver flowering stage	9.564
	SRR8316904	Silver flowering stage	10.377
	SRR8316905	Silver flowering stage	4.490
	SRR8316906	Gold flowering stage	11.405
	SRR8316907	Gold flowering stage	12.613
	SRR8316908	Gold flowering stage	12.406
SRP132670	SRR6706286	Control	10.271
	SRR6706287	Light intensity 50%	12.700
	SRR6706288	Light intensity 20%	13.301
CNP0000432	CNS0095592	Slightly white alabastrum(diploid) 1	78.973
	CNS0095593	Slightly white alabastrum(diploid) 2	87.284
	CNS0095594	Slightly white alabastrum(diploid) 3	80.907
	CNS0095595	Whole white alabastrum(diploid) 2	73.636
	CNS0095596	Whole white alabastrum(diploid) 3	33.946
	CNS0095597	Whole white alabastrum(diploid) 4	65.848
	CNS0095598	Silvery flower (diploied) 1	106.659
	CNS0095599	Silvery flower (diploied) 2	83.686
	CNS0095600	Silvery flower (diploied) 3	57.079
	CNS0095601	Golden flower (diploid) 1	102.716
	CNS0095602	Golden flower (diploid) 2	73.082
	CNS0095603	Golden flower (diploid) 3	66.234
	CNS0095604	Slightly white alabastrum(tetraploid) 1	36.312
	CNS0095605	Slightly white alabastrum(tetraploid) 2	32.055
	CNS0095606	Slightly white alabastrum(tetraploid) 3	18.000
	CNS0095607	Whole white alabastrum(tetraploid) 1	41.442
	CNS0095608	Whole white alabastrum(tetraploid) 2	37.414
	CNS0095609	Whole white alabastrum(tetraploid) 3	27.092
	CNS0095610	Silvery flower (diploied) 1	13.006
	CNS0095611	Silvery flower (diploied) 2	14.514
	CNS0095612	Silvery flower (diploied) 3	23.860
	CNS0095613	Golden flower (tetraploid) 1	9.609
	CNS0095614	Golden flower (tetraploid) 2	13.538
	CNS0095615	Golden flower (tetraploid) 3	12.355
CRA001975	CRR073297	Stem 1	31.001
	CRR073298	Stem 2	23.003
	CRR073299	Stem 3	11.970
	CRR073300	Leaf 1	34.931
	CRR073301	Leaf 2	45.953
	CRR073302	Leaf 3	19.986
	CRR073303	Juvenile bud 1	19.968
	CRR073304	Juvenile bud 2	14.261
	CRR073305	Juvenile bud 3	17.092
	CRR073306	Third green 1	5.720
	CRR073307	Third green 2	10.350
	CRR073308	Third green 3	7.891
	CRR073309	Second white 1	4.062
	CRR073310	Second white 2	9.193
	CRR073311	Second white 3	4.790
	CRR073312	Silver flowering 1	8.329
	CRR073313	Silver flowering 2	6.195
	CRR073314	Silver flowering 3	5.678
	CRR073315	Gold flowering 1	15.985
	CRR073316	Gold flowering 2	41.349
	CRR073317	Gold flowering 3	8.421
	CRR073318	Tawny withering 1	48.298
	CRR073319	Tawny withering 2	114.893
	CRR073320	Tawny withering 3	73.771