Gene detail

Detail information of GWHGAAZE018793

Functional Annotation

Database	Orthologs	E value	Annotation
Nr	XP_009589116.1	2.343E-107	PREDICTED: peroxidase 43-like [Nicotiana tomentosiformis]
Swissprot	tr\|Q9SZH2\|PER43_ARATH	5E-97	Peroxidase 43 (Precursor)
trEMBL	tr\|M1DAI9\|M1DAI9_SOLTU	1E-103	Uncharacterized protein {ECO:0000313\|EnsemblPlants:PGSC0003DMT400085904}
TAIR10	AT4G25980.1	3E-79	Peroxidase superfamily protein

Location And Transcript Sequence (JBrowse)

Scaffold	Type	Start	End	Strand
GWHAAZE00000005	gene	24376785	24381824	-
GWHAAZE00000005	mRNA	24376785	24381824	-
GWHAAZE00000005	exon	24381801	24381824	-
GWHAAZE00000005	exon	24381331	24381513	-
GWHAAZE00000005	exon	24380778	24380873	-
GWHAAZE00000005	exon	24376785	24377117	-
GWHAAZE00000005	CDS	24381801	24381824	-
GWHAAZE00000005	CDS	24381331	24381513	-
GWHAAZE00000005	CDS	24380778	24380873	-
GWHAAZE00000005	CDS	24376785	24377117	-

Transcript Sequence
>GWHTAAZE018815 ATGGTACTAGTGCTTCAGCTGCAGGGGTGTGATGGGTCAATACTAATCGAGAATGGGGCAAATGCAGAGAGAAATGCATTTGGCCACCAAGGTGTCGGAGGTTTTGAAGTGATTGAAAAAGCAAAGTCGCAGTTGGAAGCTCTATGCCCCGGTGTTGTTTCTTGTGCTGATATTGTTGCATTGGCTGCTAGAGATGCTATTGCTTTGACAAAGGGACCATCTTATGAGGTTGAAACAGGAAGAAGAGATGGAGTGATTTCGGATATGTCAACGGCTGATAAGATGCCAGATGTCACTGATTCACGACTCTATAACTTCATCCCTGGCGGCGGTTCCGATCCGGCCATAAACCCTAATTTCCTCCAAGAGCTCAAATCCAAATGCCCAAAAAACGGAGACGTAAACGTGCGATTAGCCATAGACCAAGGCAGTGAACAAACATTCGACAGCCAAATTCTGCAGAACATAAGGAGCGGCTTTGCAGTGCTACAATCTGATGCCAGACTATATGCCGATGCAGCCACAAGGAATGTGGTGGACTCTTACTTCGGGTTCCTAAACCCCTTTTTTGGTCCGTCTTTCGAGGCAGATTTTGCAAATTCAATGGTGAAAATGGGAAGGATAGAAGTGAAGACA

Network for GWHGAAZE018793

Network category	Network	Top300 PCC genelist
Coexpression Positive	Network	Top300 PCC genelist
Coexpression Negative	Network	Top300 PCC genelist

Functional Module

Module ID	Function Annotation

Protein Structure

Pfam accession	Pfam name	Alignment start	Alignment end	E-value
PF00141.24	peroxidase	8	100	5.30E-26
PF00141.24	peroxidase	101	182	2.50E-08

Protein Sequence

Gene family

Gene family	subfamily
--	--

KEGG pathway

KO	Enzyme	pathway	mapID
K00430	E1.11.1.7	Metabolic pathways	map01100
		Biosynthesis of secondary metabolites	map01110
		Phenylpropanoid biosynthesis	map00940

Gene Ontology

GO term	Ontology	Name
GO:0006979	biological_process	response to oxidative stress
GO:0055114	biological_process	oxidation-reduction process
GO:0004601	molecular_function	peroxidase activity
GO:0020037	molecular_function	heme binding

Expression pattern

Expression pattern detail

SRP	Sample	Description	TPM
SRP075780	SRR3591705	youngest leaf	1.899
	SRR3591706	second leaf	17.845
	SRR3591707	mature leaf	4.792
	SRR3591708	Shoot apex	12.476
	SRR3591709	Stem	0.690
	SRR3591710	White floral bud	3.851
	SRR3591711	White flower	1.943
	SRR3591712	Green floral bud	8.565
	SRR3591713	Yellow flower	0.963
SRP173429	SRR8316895	Juvenile bud stage	8.807
	SRR8316896	Juvenile bud stage	7.647
	SRR8316897	Juvenile bud stage	2.284
	SRR8316894	Third green stage	2.365
	SRR8316900	Third green stage	6.728
	SRR8316901	Third green stage	5.437
	SRR8316898	Complete white stage	0.683
	SRR8316899	Complete white stage	8.137
	SRR8316903	Complete white stage	2.390
	SRR8316902	Silver flowering stage	0.484
	SRR8316904	Silver flowering stage	0.345
	SRR8316905	Silver flowering stage	0.176
	SRR8316906	Gold flowering stage	0.215
	SRR8316907	Gold flowering stage	0.987
	SRR8316908	Gold flowering stage	0.100
SRP132670	SRR6706286	Control	9.809
	SRR6706287	Light intensity 50%	9.271
	SRR6706288	Light intensity 20%	9.696
CNP0000432	CNS0095592	Slightly white alabastrum(diploid) 1	6.766
	CNS0095593	Slightly white alabastrum(diploid) 2	3.726
	CNS0095594	Slightly white alabastrum(diploid) 3	6.499
	CNS0095595	Whole white alabastrum(diploid) 2	4.344
	CNS0095596	Whole white alabastrum(diploid) 3	2.666
	CNS0095597	Whole white alabastrum(diploid) 4	3.509
	CNS0095598	Silvery flower (diploied) 1	2.587
	CNS0095599	Silvery flower (diploied) 2	3.565
	CNS0095600	Silvery flower (diploied) 3	1.804
	CNS0095601	Golden flower (diploid) 1	3.182
	CNS0095602	Golden flower (diploid) 2	2.969
	CNS0095603	Golden flower (diploid) 3	2.894
	CNS0095604	Slightly white alabastrum(tetraploid) 1	5.335
	CNS0095605	Slightly white alabastrum(tetraploid) 2	5.847
	CNS0095606	Slightly white alabastrum(tetraploid) 3	9.954
	CNS0095607	Whole white alabastrum(tetraploid) 1	1.745
	CNS0095608	Whole white alabastrum(tetraploid) 2	1.891
	CNS0095609	Whole white alabastrum(tetraploid) 3	4.488
	CNS0095610	Silvery flower (diploied) 1	1.236
	CNS0095611	Silvery flower (diploied) 2	1.751
	CNS0095612	Silvery flower (diploied) 3	0.946
	CNS0095613	Golden flower (tetraploid) 1	0.434
	CNS0095614	Golden flower (tetraploid) 2	0.506
	CNS0095615	Golden flower (tetraploid) 3	0.599
CRA001975	CRR073297	Stem 1	10.677
	CRR073298	Stem 2	9.637
	CRR073299	Stem 3	11.786
	CRR073300	Leaf 1	12.718
	CRR073301	Leaf 2	11.898
	CRR073302	Leaf 3	10.449
	CRR073303	Juvenile bud 1	10.243
	CRR073304	Juvenile bud 2	3.109
	CRR073305	Juvenile bud 3	8.636
	CRR073306	Third green 1	2.387
	CRR073307	Third green 2	1.954
	CRR073308	Third green 3	1.897
	CRR073309	Second white 1	0.581
	CRR073310	Second white 2	0.000
	CRR073311	Second white 3	0.430
	CRR073312	Silver flowering 1	0.104
	CRR073313	Silver flowering 2	0.200
	CRR073314	Silver flowering 3	0.316
	CRR073315	Gold flowering 1	6.943
	CRR073316	Gold flowering 2	5.291
	CRR073317	Gold flowering 3	8.911
	CRR073318	Tawny withering 1	0.149
	CRR073319	Tawny withering 2	1.845
	CRR073320	Tawny withering 3	0.000