Gene detail

Detail information of GWHGAAZE019454

Functional Annotation

Database	Orthologs	E value	Annotation
Nr	XP_010273536.1	2.66659E-75	PREDICTED: putative protease Do-like 14 [Nelumbo nucifera]
Swissprot	tr\|Q3E6S8\|DGP14_ARATH	4E-71	Putative protease Do-like 14
trEMBL	tr\|A0A061F2B1\|A0A061F2B1_THECC	1E-74	Trypsin family protein with PDZ domain isoform 3 {ECO:0000313\|EMBL:EOY11480.1}
TAIR10	AT5G27660.1	5E-59	Trypsin family protein with PDZ domain

Location And Transcript Sequence (JBrowse)

Scaffold	Type	Start	End	Strand
GWHAAZE00000005	gene	43641395	43644058	+
GWHAAZE00000005	mRNA	43641395	43644058	+
GWHAAZE00000005	exon	43641395	43641651	+
GWHAAZE00000005	exon	43641966	43642047	+
GWHAAZE00000005	exon	43642648	43642794	+
GWHAAZE00000005	exon	43644011	43644058	+
GWHAAZE00000005	CDS	43641395	43641651	+
GWHAAZE00000005	CDS	43641966	43642047	+
GWHAAZE00000005	CDS	43642648	43642794	+
GWHAAZE00000005	CDS	43644011	43644058	+

Transcript Sequence
>GWHTAAZE019476 ATGACATGTACACCACTGTTTGACTTTGAATTGTTTCGACTGAAGGTTGACGTGATCTTGCATGATGGTCGAACATTTGTGGGTACGGTGGTAAATGCTGATTTACATTCCGATATTGCTATTGTGAAGATCACATCTAGTACTCCATTTCCATCAGCAAAACTTGGCTCCTCATGTAAGCTAGATCCAGGGGATTGGGTAGTAGCTATGGGATGTCCCCGCTCCCTTCAGCACACTATTACAGCTGGCATTGTTAGCTGTGTTAATCGCAAAAGTAGCGAAATAGGACTTGGTGGAATGCTGAGAGAGTATATTCAGATAGATTGTGCAATCAATCCGGGAAATTCTGGTGGACCCCTTGTTAATCTCGATGGAGAAGTTGTTGGTGTTAATGTTATGAAATTTACAACTGCAACTGGGTTGAATTTTGCCGTACCAATGGACACAATTTCCAAAATCATGAAGCAGTTCAAGAAAAAAGGGTACGAGAATTATTCGACCTTGGCTTGGATTGAAAATGCTCGACCTCAATGA

Network for GWHGAAZE019454

Network category	Network	Top300 PCC genelist
Coexpression Positive	Network	Top300 PCC genelist
Coexpression Negative	Network	Top300 PCC genelist

Functional Module

Module ID	Function Annotation

Protein Structure

Pfam accession	Pfam name	Alignment start	Alignment end	E-value
PF13365.7	Trypsin_2	14	130	8.30E-24

Protein Sequence

Gene family

Gene family	subfamily
--	--

KEGG pathway

KO	Enzyme	pathway	mapID
K08669	HTRA2, PRSS25	Apoptosis	map04210
		Apoptosis - fly	map04214
		Apoptosis - multiple species	map04215

Gene Ontology

GO term	Ontology	Name
GO:0006508	biological_process	proteolysis
GO:0004252	molecular_function	serine-type endopeptidase activity

Expression pattern

Expression pattern detail

SRP	Sample	Description	TPM
SRP075780	SRR3591705	youngest leaf	8.933
	SRR3591706	second leaf	1.663
	SRR3591707	mature leaf	1.603
	SRR3591708	Shoot apex	6.086
	SRR3591709	Stem	8.452
	SRR3591710	White floral bud	13.794
	SRR3591711	White flower	14.502
	SRR3591712	Green floral bud	12.116
	SRR3591713	Yellow flower	10.770
SRP173429	SRR8316895	Juvenile bud stage	4.250
	SRR8316896	Juvenile bud stage	4.354
	SRR8316897	Juvenile bud stage	4.764
	SRR8316894	Third green stage	2.016
	SRR8316900	Third green stage	4.922
	SRR8316901	Third green stage	6.928
	SRR8316898	Complete white stage	3.799
	SRR8316899	Complete white stage	16.386
	SRR8316903	Complete white stage	8.223
	SRR8316902	Silver flowering stage	3.944
	SRR8316904	Silver flowering stage	7.152
	SRR8316905	Silver flowering stage	3.894
	SRR8316906	Gold flowering stage	11.391
	SRR8316907	Gold flowering stage	9.992
	SRR8316908	Gold flowering stage	10.283
SRP132670	SRR6706286	Control	5.600
	SRR6706287	Light intensity 50%	4.812
	SRR6706288	Light intensity 20%	5.245
CNP0000432	CNS0095592	Slightly white alabastrum(diploid) 1	3.315
	CNS0095593	Slightly white alabastrum(diploid) 2	3.899
	CNS0095594	Slightly white alabastrum(diploid) 3	2.049
	CNS0095595	Whole white alabastrum(diploid) 2	1.689
	CNS0095596	Whole white alabastrum(diploid) 3	2.347
	CNS0095597	Whole white alabastrum(diploid) 4	3.137
	CNS0095598	Silvery flower (diploied) 1	7.376
	CNS0095599	Silvery flower (diploied) 2	6.101
	CNS0095600	Silvery flower (diploied) 3	6.465
	CNS0095601	Golden flower (diploid) 1	6.871
	CNS0095602	Golden flower (diploid) 2	8.328
	CNS0095603	Golden flower (diploid) 3	7.854
	CNS0095604	Slightly white alabastrum(tetraploid) 1	3.532
	CNS0095605	Slightly white alabastrum(tetraploid) 2	2.341
	CNS0095606	Slightly white alabastrum(tetraploid) 3	6.835
	CNS0095607	Whole white alabastrum(tetraploid) 1	1.793
	CNS0095608	Whole white alabastrum(tetraploid) 2	1.910
	CNS0095609	Whole white alabastrum(tetraploid) 3	6.234
	CNS0095610	Silvery flower (diploied) 1	7.985
	CNS0095611	Silvery flower (diploied) 2	11.941
	CNS0095612	Silvery flower (diploied) 3	7.348
	CNS0095613	Golden flower (tetraploid) 1	3.331
	CNS0095614	Golden flower (tetraploid) 2	4.584
	CNS0095615	Golden flower (tetraploid) 3	4.707
CRA001975	CRR073297	Stem 1	5.850
	CRR073298	Stem 2	4.702
	CRR073299	Stem 3	2.775
	CRR073300	Leaf 1	5.618
	CRR073301	Leaf 2	5.301
	CRR073302	Leaf 3	4.546
	CRR073303	Juvenile bud 1	5.626
	CRR073304	Juvenile bud 2	4.271
	CRR073305	Juvenile bud 3	7.712
	CRR073306	Third green 1	2.013
	CRR073307	Third green 2	1.962
	CRR073308	Third green 3	2.531
	CRR073309	Second white 1	1.264
	CRR073310	Second white 2	1.410
	CRR073311	Second white 3	1.102
	CRR073312	Silver flowering 1	0.430
	CRR073313	Silver flowering 2	0.855
	CRR073314	Silver flowering 3	0.518
	CRR073315	Gold flowering 1	0.465
	CRR073316	Gold flowering 2	1.314
	CRR073317	Gold flowering 3	1.294
	CRR073318	Tawny withering 1	6.668
	CRR073319	Tawny withering 2	5.193
	CRR073320	Tawny withering 3	9.110