Gene detail

Detail information of GWHGAAZE020229

Functional Annotation

Database	Orthologs	E value	Annotation
Nr	XP_009759469.1	1.59942E-45	PREDICTED: protein kinase APK1A, chloroplastic-like [Nicotiana sylvestris]
Swissprot	tr\|P43293\|NAK_ARATH	5E-43	Probable serine/threonine-protein kinase NAK
trEMBL	tr\|M0ZT38\|M0ZT38_SOLTU	6E-47	Uncharacterized protein {ECO:0000313\|EnsemblPlants:PGSC0003DMT400007504}
TAIR10	AT2G07180.2	5E-38	Protein kinase superfamily protein

Location And Transcript Sequence (JBrowse)

Scaffold	Type	Start	End	Strand
GWHAAZE00000005	gene	80890708	80893216	-
GWHAAZE00000005	mRNA	80890708	80893216	-
GWHAAZE00000005	exon	80890708	80891014	-
GWHAAZE00000005	exon	80892356	80892532	-
GWHAAZE00000005	exon	80892878	80893023	-
GWHAAZE00000005	exon	80893208	80893216	-
GWHAAZE00000005	CDS	80893208	80893216	-
GWHAAZE00000005	CDS	80892878	80893023	-
GWHAAZE00000005	CDS	80892356	80892532	-
GWHAAZE00000005	CDS	80890708	80891014	-

Transcript Sequence
>GWHTAAZE020251 ATGCACAAAACTGAGGCCGAGGTAATTTATTTAGGAAATCTCCGACACCCGAATCTGGTGAAGCTAATTGGCTACTGTCTCGATGGCGAACATGGGTATTTGGTTTATGAATATATGGAATCTGGTAACCTCGATAAACTCCTTTTTCGTGGTGATACGAGTTTTATTTATTTATTTATTTCATTTTTGTTGGTTAGAAGATGGAAAACATTGAATTGGACAAGAAGAAAGAAGATTGCTTTGGATGTTGCAAAAGGATTCGCTTTTCTTGAGGCCCTGAAAAACCTATCCTTTATCTCTATTTCAAGACCTCAAACATCTTGTTGGATAGGGGCTTTAACTAATAAAACTAATGTATATGCATTCGGGGTGGTGCTACTTGAAATGCTGACCGGAAGGAGCGTCATTGACAAGACCAAGTCGCCTTTGTCCGTAGATTACCTGCTCAACTTTGCCCGCCCGTGCCTCAGCCAATACAACAAACTCCGGTCAATATTAGACCAGCGAATAGAGGGGCAATACAGTCGGGAAGATATACTGCCTGTGGCAGTTCTTGCTCTGAAATGCCTCAGCAAAGACCCGAAAGATAGGCCGCCCATGAACGAAGTTGTCAAAGCACTAGAAGCTTCCGGTTCTTGA

Network for GWHGAAZE020229

Network category	Network	Top300 PCC genelist
Coexpression Positive	Network	Top300 PCC genelist
Coexpression Negative	Network	Top300 PCC genelist

Functional Module

Module ID	Function Annotation

Protein Structure

Pfam accession	Pfam name	Alignment start	Alignment end	E-value
PF07714.18	PK_Tyr_Ser-Thr	5	92	5.00E-11

Protein Sequence

Gene family

Gene family	subfamily
Protein Kinases Family	RLK-Pelle_RLCK-VIIa-2

KEGG pathway

KO	Enzyme	pathway	mapID
--	--	--	--

Gene Ontology

GO term	Ontology	Name
GO:0006468	biological_process	protein phosphorylation
GO:0004672	molecular_function	protein kinase activity
GO:0005524	molecular_function	ATP binding

Expression pattern

Expression pattern detail

SRP	Sample	Description	TPM
SRP075780	SRR3591705	youngest leaf	0.000
	SRR3591706	second leaf	0.000
	SRR3591707	mature leaf	0.000
	SRR3591708	Shoot apex	0.000
	SRR3591709	Stem	0.000
	SRR3591710	White floral bud	0.202
	SRR3591711	White flower	0.000
	SRR3591712	Green floral bud	0.000
	SRR3591713	Yellow flower	0.000
SRP173429	SRR8316895	Juvenile bud stage	0.531
	SRR8316896	Juvenile bud stage	0.078
	SRR8316897	Juvenile bud stage	0.000
	SRR8316894	Third green stage	0.044
	SRR8316900	Third green stage	0.033
	SRR8316901	Third green stage	0.177
	SRR8316898	Complete white stage	0.000
	SRR8316899	Complete white stage	0.421
	SRR8316903	Complete white stage	0.326
	SRR8316902	Silver flowering stage	0.000
	SRR8316904	Silver flowering stage	0.000
	SRR8316905	Silver flowering stage	0.000
	SRR8316906	Gold flowering stage	0.498
	SRR8316907	Gold flowering stage	0.146
	SRR8316908	Gold flowering stage	0.000
SRP132670	SRR6706286	Control	0.043
	SRR6706287	Light intensity 50%	0.013
	SRR6706288	Light intensity 20%	0.042
CNP0000432	CNS0095592	Slightly white alabastrum(diploid) 1	0.407
	CNS0095593	Slightly white alabastrum(diploid) 2	0.618
	CNS0095594	Slightly white alabastrum(diploid) 3	0.225
	CNS0095595	Whole white alabastrum(diploid) 2	2.291
	CNS0095596	Whole white alabastrum(diploid) 3	0.112
	CNS0095597	Whole white alabastrum(diploid) 4	0.265
	CNS0095598	Silvery flower (diploied) 1	0.827
	CNS0095599	Silvery flower (diploied) 2	0.344
	CNS0095600	Silvery flower (diploied) 3	0.179
	CNS0095601	Golden flower (diploid) 1	1.903
	CNS0095602	Golden flower (diploid) 2	0.952
	CNS0095603	Golden flower (diploid) 3	0.823
	CNS0095604	Slightly white alabastrum(tetraploid) 1	0.143
	CNS0095605	Slightly white alabastrum(tetraploid) 2	0.096
	CNS0095606	Slightly white alabastrum(tetraploid) 3	0.355
	CNS0095607	Whole white alabastrum(tetraploid) 1	0.510
	CNS0095608	Whole white alabastrum(tetraploid) 2	0.000
	CNS0095609	Whole white alabastrum(tetraploid) 3	0.055
	CNS0095610	Silvery flower (diploied) 1	0.000
	CNS0095611	Silvery flower (diploied) 2	0.075
	CNS0095612	Silvery flower (diploied) 3	0.043
	CNS0095613	Golden flower (tetraploid) 1	0.083
	CNS0095614	Golden flower (tetraploid) 2	0.359
	CNS0095615	Golden flower (tetraploid) 3	0.052
CRA001975	CRR073297	Stem 1	0.141
	CRR073298	Stem 2	0.103
	CRR073299	Stem 3	0.000
	CRR073300	Leaf 1	0.000
	CRR073301	Leaf 2	0.000
	CRR073302	Leaf 3	0.011
	CRR073303	Juvenile bud 1	0.000
	CRR073304	Juvenile bud 2	0.169
	CRR073305	Juvenile bud 3	0.000
	CRR073306	Third green 1	0.000
	CRR073307	Third green 2	0.000
	CRR073308	Third green 3	0.000
	CRR073309	Second white 1	0.000
	CRR073310	Second white 2	0.104
	CRR073311	Second white 3	0.000
	CRR073312	Silver flowering 1	0.045
	CRR073313	Silver flowering 2	0.047
	CRR073314	Silver flowering 3	0.230
	CRR073315	Gold flowering 1	0.000
	CRR073316	Gold flowering 2	0.000
	CRR073317	Gold flowering 3	0.000
	CRR073318	Tawny withering 1	0.000
	CRR073319	Tawny withering 2	0.000
	CRR073320	Tawny withering 3	0.000