Gene detail

Detail information of GWHGAAZE020612

Functional Annotation

Database	Orthologs	E value	Annotation
Nr	AHF22089.1	1.32334E-44	CYP79D33 [Maesa lanceolata]
Swissprot	tr\|Q9FLC8\|C79A2_ARATH	6E-38	Phenylalanine N-monooxygenase
trEMBL	tr\|K4CPY6\|K4CPY6_SOLLC	5E-40	Uncharacterized protein {ECO:0000313\|EnsemblPlants:Solyc08g083450.1.1}
TAIR10	AT5G05260.1	2E-32	cytochrome p450 79a2

Location And Transcript Sequence (JBrowse)

Scaffold	Type	Start	End	Strand
GWHAAZE00000006	gene	12584552	12585007	+
GWHAAZE00000006	mRNA	12584552	12585007	+
GWHAAZE00000006	exon	12584552	12585007	+
GWHAAZE00000006	CDS	12584552	12585007	+

Transcript Sequence
>GWHTAAZE020636 ATGGAGAGCAACTTTGTTACAACACTTAATTCCTCAGCCTTGAGCTTAGCCATGCTTTTATTAGCACTTTTTTTCTTTAGTGTCATGTACTTGTTACGAAAAAGGTCAAACCTCCCACCAGGCCCCATGGGATGGCCTATTACCGGGAGCCTACACGTATTGTTTACATGCAAGCCTATATTTCGATGGATTCATAGGCTCATGCATAAGATGAATACAAAAATCATATGTATCCGCTTCCTAAACACCCATGTCATTGTTGTGTCTAGCGATGATTTGGAAAAAAAGTTCTTAAAGACACAAGACGCCGTGTTTTCTTCAAGACCTATTTCTTTAGCTTCTGAAATCACCAGTGGTGGATACATGACAACTGCCTTTAGTCCCATGGGAGAGCAATGGAAAAAAATGAGGAGAATCCTTGCCACTGAAATCCTTTCCAAGAATAGACACAAGTGA

Network for GWHGAAZE020612

Network category	Network	Top300 PCC genelist
Coexpression Positive	Network	Top300 PCC genelist
Coexpression Negative	Network	Top300 PCC genelist

Functional Module

Module ID	Function Annotation

Protein Structure

Pfam accession	Pfam name	Alignment start	Alignment end	E-value
PF00067.23	p450	39	147	4.20E-08

Protein Sequence

Gene family

Gene family	subfamily
--	--

KEGG pathway

KO	Enzyme	pathway	mapID
K12153	CYP79A2	Metabolic pathways	map01100
		Biosynthesis of secondary metabolites	map01110
		2-Oxocarboxylic acid metabolism	map01210
		Cyanoamino acid metabolism	map00460
		Glucosinolate biosynthesis	map00966

Gene Ontology

GO term	Ontology	Name
GO:0055114	biological_process	oxidation-reduction process
GO:0005506	molecular_function	iron ion binding
GO:0016705	molecular_function	oxidoreductase activity, acting on paired donors, with incorporation or reduction of molecular oxygen
GO:0020037	molecular_function	heme binding

Expression pattern

Expression pattern detail

SRP	Sample	Description	TPM
SRP075780	SRR3591705	youngest leaf	0.000
	SRR3591706	second leaf	0.000
	SRR3591707	mature leaf	0.000
	SRR3591708	Shoot apex	0.000
	SRR3591709	Stem	0.000
	SRR3591710	White floral bud	0.683
	SRR3591711	White flower	1.524
	SRR3591712	Green floral bud	0.000
	SRR3591713	Yellow flower	2.060
SRP173429	SRR8316895	Juvenile bud stage	0.000
	SRR8316896	Juvenile bud stage	0.000
	SRR8316897	Juvenile bud stage	0.000
	SRR8316894	Third green stage	0.000
	SRR8316900	Third green stage	0.000
	SRR8316901	Third green stage	0.000
	SRR8316898	Complete white stage	0.000
	SRR8316899	Complete white stage	0.000
	SRR8316903	Complete white stage	0.000
	SRR8316902	Silver flowering stage	16.522
	SRR8316904	Silver flowering stage	23.526
	SRR8316905	Silver flowering stage	22.084
	SRR8316906	Gold flowering stage	37.882
	SRR8316907	Gold flowering stage	36.289
	SRR8316908	Gold flowering stage	23.968
SRP132670	SRR6706286	Control	0.000
	SRR6706287	Light intensity 50%	0.000
	SRR6706288	Light intensity 20%	0.000
CNP0000432	CNS0095592	Slightly white alabastrum(diploid) 1	0.000
	CNS0095593	Slightly white alabastrum(diploid) 2	0.000
	CNS0095594	Slightly white alabastrum(diploid) 3	0.000
	CNS0095595	Whole white alabastrum(diploid) 2	0.000
	CNS0095596	Whole white alabastrum(diploid) 3	0.000
	CNS0095597	Whole white alabastrum(diploid) 4	0.000
	CNS0095598	Silvery flower (diploied) 1	0.000
	CNS0095599	Silvery flower (diploied) 2	0.006
	CNS0095600	Silvery flower (diploied) 3	9.717
	CNS0095601	Golden flower (diploid) 1	0.923
	CNS0095602	Golden flower (diploid) 2	9.734
	CNS0095603	Golden flower (diploid) 3	11.299
	CNS0095604	Slightly white alabastrum(tetraploid) 1	0.000
	CNS0095605	Slightly white alabastrum(tetraploid) 2	0.000
	CNS0095606	Slightly white alabastrum(tetraploid) 3	0.000
	CNS0095607	Whole white alabastrum(tetraploid) 1	0.121
	CNS0095608	Whole white alabastrum(tetraploid) 2	0.000
	CNS0095609	Whole white alabastrum(tetraploid) 3	0.065
	CNS0095610	Silvery flower (diploied) 1	11.969
	CNS0095611	Silvery flower (diploied) 2	23.873
	CNS0095612	Silvery flower (diploied) 3	223.952
	CNS0095613	Golden flower (tetraploid) 1	42.216
	CNS0095614	Golden flower (tetraploid) 2	23.472
	CNS0095615	Golden flower (tetraploid) 3	72.565
CRA001975	CRR073297	Stem 1	0.000
	CRR073298	Stem 2	0.059
	CRR073299	Stem 3	0.031
	CRR073300	Leaf 1	0.034
	CRR073301	Leaf 2	0.199
	CRR073302	Leaf 3	0.075
	CRR073303	Juvenile bud 1	0.013
	CRR073304	Juvenile bud 2	0.051
	CRR073305	Juvenile bud 3	0.089
	CRR073306	Third green 1	9.809
	CRR073307	Third green 2	6.228
	CRR073308	Third green 3	5.069
	CRR073309	Second white 1	35.433
	CRR073310	Second white 2	46.509
	CRR073311	Second white 3	46.746
	CRR073312	Silver flowering 1	36.102
	CRR073313	Silver flowering 2	28.568
	CRR073314	Silver flowering 3	26.404
	CRR073315	Gold flowering 1	0.000
	CRR073316	Gold flowering 2	0.041
	CRR073317	Gold flowering 3	0.000
	CRR073318	Tawny withering 1	0.000
	CRR073319	Tawny withering 2	0.000
	CRR073320	Tawny withering 3	0.000