Gene detail

Detail information of GWHGAAZE020865

Functional Annotation

Database	Orthologs	E value	Annotation
Nr	XP_010516002.1	5.0783E-26	PREDICTED: glutathione reductase, chloroplastic-like [Camelina sativa]
COG	YP_003897656.1	1E-16	glutathione reductase
Swissprot	tr\|P80461\|GSHRP_TOBAC	5E-25	Glutathione reductase, chloroplastic (Precursor; Fragment)
trEMBL	tr\|I6PBY2\|I6PBY2_9ROSI	1E-25	Glutathione reductase {ECO:0000313\|EMBL:AFF18773.1} (Fragment)
TAIR10	AT3G54660.1	2E-21	glutathione reductase

Location And Transcript Sequence (JBrowse)

Scaffold	Type	Start	End	Strand
GWHAAZE00000006	gene	23925772	23926022	-
GWHAAZE00000006	mRNA	23925772	23926022	-
GWHAAZE00000006	exon	23925990	23926022	-
GWHAAZE00000006	exon	23925772	23925906	-
GWHAAZE00000006	CDS	23925990	23926022	-
GWHAAZE00000006	CDS	23925772	23925906	-

Transcript Sequence
>GWHTAAZE020889 ATGTGTGGTGAAGATTCTGCAGAAATTGTTCAGGGATTTGGAATAGCTGTGAAAGCTGGCTTAACCAAGGCAGACTTCGATACCACAGTGGGAATTCACCCTAAAGCAACTGAGGAGTTTGTCACTATGAGGACGCCTACACGGAAGATTCGAAGCAGCTCTCCCGAG

Network for GWHGAAZE020865

Network category	Network	Top300 PCC genelist
Coexpression Positive	Network	Top300 PCC genelist
Coexpression Negative	Network	Top300 PCC genelist

Functional Module

Module ID	Function Annotation

Protein Structure

Pfam accession	Pfam name	Alignment start	Alignment end	E-value
PF02852.23	Pyr_redox_dim	1	43	2.90E-09

Protein Sequence

Gene family

Gene family	subfamily
--	--

KEGG pathway

KO	Enzyme	pathway	mapID
K00383	GSR, gor	Metabolic pathways	map01100
		Glutathione metabolism	map00480
		Thyroid hormone synthesis	map04918

Gene Ontology

GO term	Ontology	Name
GO:0055114	biological_process	oxidation-reduction process
GO:0045454	biological_process	cell redox homeostasis
GO:0016491	molecular_function	oxidoreductase activity
GO:0050660	molecular_function	flavin adenine dinucleotide binding

Expression pattern

Expression pattern detail

SRP	Sample	Description	TPM
SRP075780	SRR3591705	youngest leaf	8.209
	SRR3591706	second leaf	8.452
	SRR3591707	mature leaf	4.090
	SRR3591708	Shoot apex	11.510
	SRR3591709	Stem	6.422
	SRR3591710	White floral bud	0.000
	SRR3591711	White flower	0.000
	SRR3591712	Green floral bud	0.000
	SRR3591713	Yellow flower	0.000
SRP173429	SRR8316895	Juvenile bud stage	1.125
	SRR8316896	Juvenile bud stage	1.254
	SRR8316897	Juvenile bud stage	0.580
	SRR8316894	Third green stage	0.944
	SRR8316900	Third green stage	4.110
	SRR8316901	Third green stage	5.614
	SRR8316898	Complete white stage	3.498
	SRR8316899	Complete white stage	10.463
	SRR8316903	Complete white stage	6.351
	SRR8316902	Silver flowering stage	1.555
	SRR8316904	Silver flowering stage	2.732
	SRR8316905	Silver flowering stage	0.319
	SRR8316906	Gold flowering stage	1.626
	SRR8316907	Gold flowering stage	2.028
	SRR8316908	Gold flowering stage	3.712
SRP132670	SRR6706286	Control	5.878
	SRR6706287	Light intensity 50%	8.072
	SRR6706288	Light intensity 20%	5.501
CNP0000432	CNS0095592	Slightly white alabastrum(diploid) 1	3.773
	CNS0095593	Slightly white alabastrum(diploid) 2	2.565
	CNS0095594	Slightly white alabastrum(diploid) 3	2.956
	CNS0095595	Whole white alabastrum(diploid) 2	2.068
	CNS0095596	Whole white alabastrum(diploid) 3	3.813
	CNS0095597	Whole white alabastrum(diploid) 4	4.071
	CNS0095598	Silvery flower (diploied) 1	3.605
	CNS0095599	Silvery flower (diploied) 2	2.234
	CNS0095600	Silvery flower (diploied) 3	1.326
	CNS0095601	Golden flower (diploid) 1	2.357
	CNS0095602	Golden flower (diploid) 2	1.816
	CNS0095603	Golden flower (diploid) 3	1.463
	CNS0095604	Slightly white alabastrum(tetraploid) 1	3.131
	CNS0095605	Slightly white alabastrum(tetraploid) 2	3.004
	CNS0095606	Slightly white alabastrum(tetraploid) 3	9.577
	CNS0095607	Whole white alabastrum(tetraploid) 1	2.221
	CNS0095608	Whole white alabastrum(tetraploid) 2	0.644
	CNS0095609	Whole white alabastrum(tetraploid) 3	5.187
	CNS0095610	Silvery flower (diploied) 1	6.463
	CNS0095611	Silvery flower (diploied) 2	3.931
	CNS0095612	Silvery flower (diploied) 3	3.919
	CNS0095613	Golden flower (tetraploid) 1	3.241
	CNS0095614	Golden flower (tetraploid) 2	2.067
	CNS0095615	Golden flower (tetraploid) 3	1.552
CRA001975	CRR073297	Stem 1	1.826
	CRR073298	Stem 2	5.387
	CRR073299	Stem 3	0.449
	CRR073300	Leaf 1	4.634
	CRR073301	Leaf 2	9.970
	CRR073302	Leaf 3	3.196
	CRR073303	Juvenile bud 1	2.595
	CRR073304	Juvenile bud 2	2.068
	CRR073305	Juvenile bud 3	0.855
	CRR073306	Third green 1	0.770
	CRR073307	Third green 2	0.000
	CRR073308	Third green 3	0.907
	CRR073309	Second white 1	0.000
	CRR073310	Second white 2	0.000
	CRR073311	Second white 3	0.000
	CRR073312	Silver flowering 1	0.632
	CRR073313	Silver flowering 2	0.000
	CRR073314	Silver flowering 3	0.000
	CRR073315	Gold flowering 1	2.438
	CRR073316	Gold flowering 2	0.786
	CRR073317	Gold flowering 3	0.000
	CRR073318	Tawny withering 1	2.524
	CRR073319	Tawny withering 2	8.396
	CRR073320	Tawny withering 3	0.000