Gene detail

Detail information of GWHGAAZE020866

Functional Annotation

Database	Orthologs	E value	Annotation
Nr	AFF18775.1	2.21955E-38	glutathione reductase, partial [Dimocarpus longan]
COG	YP_005366158.1	1E-12	glutathione-disulfide reductase
Swissprot	tr\|P80461\|GSHRP_TOBAC	3E-38	Glutathione reductase, chloroplastic (Precursor; Fragment)
trEMBL	tr\|I6P9G4\|I6P9G4_9ROSI	8E-39	Glutathione reductase {ECO:0000313\|EMBL:AFF18775.1} (Fragment)
TAIR10	AT3G54660.1	3E-32	glutathione reductase

Location And Transcript Sequence (JBrowse)

Scaffold	Type	Start	End	Strand
GWHAAZE00000006	gene	23926618	23932535	-
GWHAAZE00000006	mRNA	23926618	23932535	-
GWHAAZE00000006	exon	23932386	23932535	-
GWHAAZE00000006	exon	23932280	23932306	-
GWHAAZE00000006	exon	23932141	23932194	-
GWHAAZE00000006	exon	23926618	23926746	-
GWHAAZE00000006	CDS	23932386	23932535	-
GWHAAZE00000006	CDS	23932280	23932306	-
GWHAAZE00000006	CDS	23932141	23932194	-
GWHAAZE00000006	CDS	23926618	23926746	-

Transcript Sequence
>GWHTAAZE020890 ATGTCTTTAAAAGGTATTAAGTTCCATGCGGAGGAGTTGCCTCAGGCTATAATTAAATCAACAAATGGTACATTGACCTTGAAGATGAACAAAGGAACCAGAAAAGGTTTCTCACGTATCCTGTTTGCTACAGGCAAGCTTAATACAAAGAGTACCCGCAAAGGAATATGTGAACCAAATTTAGGACTGGAGACAGTAAGGGTGAAAATGGCCACGAATGGAGCAATAATGGTTCATGAGGACTCCTGTATGTCAGTTCCATCTATTTGGGCAGTCGGAGCTGTTGCGGATAGATTGAATTTGACTCCAGTTGCTTTGATGGAGGGAGGGGGCGTTGGGCAAAACTCTGTTTTTGAATAA

Network for GWHGAAZE020866

Network category	Network	Top300 PCC genelist
Coexpression Positive	Network	Top300 PCC genelist
Coexpression Negative	Network	Top300 PCC genelist

Functional Module

Module ID	Function Annotation

Protein Structure

Pfam accession	Pfam name	Alignment start	Alignment end	E-value
PF07992.15	Pyr_redox_2	4	109	1.40E-08

Protein Sequence

Gene family

Gene family	subfamily
--	--

KEGG pathway

KO	Enzyme	pathway	mapID
K00383	GSR, gor	Metabolic pathways	map01100
		Glutathione metabolism	map00480
		Thyroid hormone synthesis	map04918

Gene Ontology

GO term	Ontology	Name
GO:0055114	biological_process	oxidation-reduction process
GO:0016491	molecular_function	oxidoreductase activity

Expression pattern

Expression pattern detail

SRP	Sample	Description	TPM
SRP075780	SRR3591705	youngest leaf	2.655
	SRR3591706	second leaf	0.765
	SRR3591707	mature leaf	0.270
	SRR3591708	Shoot apex	1.977
	SRR3591709	Stem	0.895
	SRR3591710	White floral bud	0.000
	SRR3591711	White flower	0.000
	SRR3591712	Green floral bud	0.000
	SRR3591713	Yellow flower	0.000
SRP173429	SRR8316895	Juvenile bud stage	0.000
	SRR8316896	Juvenile bud stage	0.183
	SRR8316897	Juvenile bud stage	0.103
	SRR8316894	Third green stage	0.267
	SRR8316900	Third green stage	0.870
	SRR8316901	Third green stage	1.061
	SRR8316898	Complete white stage	0.778
	SRR8316899	Complete white stage	1.358
	SRR8316903	Complete white stage	1.109
	SRR8316902	Silver flowering stage	0.347
	SRR8316904	Silver flowering stage	0.207
	SRR8316905	Silver flowering stage	0.166
	SRR8316906	Gold flowering stage	0.401
	SRR8316907	Gold flowering stage	0.362
	SRR8316908	Gold flowering stage	0.388
SRP132670	SRR6706286	Control	1.584
	SRR6706287	Light intensity 50%	1.615
	SRR6706288	Light intensity 20%	2.063
CNP0000432	CNS0095592	Slightly white alabastrum(diploid) 1	0.279
	CNS0095593	Slightly white alabastrum(diploid) 2	0.000
	CNS0095594	Slightly white alabastrum(diploid) 3	0.000
	CNS0095595	Whole white alabastrum(diploid) 2	0.118
	CNS0095596	Whole white alabastrum(diploid) 3	0.716
	CNS0095597	Whole white alabastrum(diploid) 4	0.089
	CNS0095598	Silvery flower (diploied) 1	0.244
	CNS0095599	Silvery flower (diploied) 2	0.772
	CNS0095600	Silvery flower (diploied) 3	0.205
	CNS0095601	Golden flower (diploid) 1	0.425
	CNS0095602	Golden flower (diploid) 2	0.325
	CNS0095603	Golden flower (diploid) 3	0.197
	CNS0095604	Slightly white alabastrum(tetraploid) 1	0.471
	CNS0095605	Slightly white alabastrum(tetraploid) 2	0.286
	CNS0095606	Slightly white alabastrum(tetraploid) 3	1.491
	CNS0095607	Whole white alabastrum(tetraploid) 1	0.099
	CNS0095608	Whole white alabastrum(tetraploid) 2	0.154
	CNS0095609	Whole white alabastrum(tetraploid) 3	0.617
	CNS0095610	Silvery flower (diploied) 1	0.649
	CNS0095611	Silvery flower (diploied) 2	0.623
	CNS0095612	Silvery flower (diploied) 3	1.083
	CNS0095613	Golden flower (tetraploid) 1	0.251
	CNS0095614	Golden flower (tetraploid) 2	0.638
	CNS0095615	Golden flower (tetraploid) 3	0.187
CRA001975	CRR073297	Stem 1	0.150
	CRR073298	Stem 2	0.942
	CRR073299	Stem 3	0.019
	CRR073300	Leaf 1	0.569
	CRR073301	Leaf 2	0.078
	CRR073302	Leaf 3	0.295
	CRR073303	Juvenile bud 1	0.000
	CRR073304	Juvenile bud 2	0.032
	CRR073305	Juvenile bud 3	0.000
	CRR073306	Third green 1	0.000
	CRR073307	Third green 2	0.000
	CRR073308	Third green 3	0.000
	CRR073309	Second white 1	0.000
	CRR073310	Second white 2	0.000
	CRR073311	Second white 3	0.000
	CRR073312	Silver flowering 1	0.000
	CRR073313	Silver flowering 2	0.000
	CRR073314	Silver flowering 3	0.000
	CRR073315	Gold flowering 1	0.277
	CRR073316	Gold flowering 2	0.000
	CRR073317	Gold flowering 3	0.000
	CRR073318	Tawny withering 1	0.227
	CRR073319	Tawny withering 2	0.000
	CRR073320	Tawny withering 3	0.000