Gene detail

Detail information of GWHGAAZE021434

Functional Annotation

Database	Orthologs	E value	Annotation
Nr	XP_008346395.1	4.01699E-78	PREDICTED: actin-related protein 2/3 complex subunit 4 [Malus domestica]
Swissprot	tr\|F4JUL9\|ARPC4_ARATH	2E-76	Actin-related protein 2/3 complex subunit 4
trEMBL	tr\|Q6X0P2\|Q6X0P2_SOYBN	2E-78	ARPC p20 {ECO:0000313\|EMBL:AAQ62581.1} (Fragment)
TAIR10	AT4G14147.1	7E-61	protein binding

Location And Transcript Sequence (JBrowse)

Scaffold	Type	Start	End	Strand
GWHAAZE00000006	gene	52807318	52813927	-
GWHAAZE00000006	mRNA	52807318	52813927	-
GWHAAZE00000006	exon	52813846	52813927	-
GWHAAZE00000006	exon	52813612	52813739	-
GWHAAZE00000006	exon	52813097	52813201	-
GWHAAZE00000006	exon	52812626	52812715	-
GWHAAZE00000006	exon	52807318	52807407	-
GWHAAZE00000006	CDS	52813846	52813927	-
GWHAAZE00000006	CDS	52813612	52813739	-
GWHAAZE00000006	CDS	52813097	52813201	-
GWHAAZE00000006	CDS	52812626	52812715	-
GWHAAZE00000006	CDS	52807318	52807407	-

Transcript Sequence
>GWHTAAZE021458 ATGGGACTCTGTTTTTGGCTGGCTGTGTCTCTTTTGTTCTTATACCCTCTAGCAGTTTTACTGCTTTGGTTTTGCTCTGCTGTCCAGTGCTGTATATGGGCTGTAATTTTATTTTTTTCCCTGTCCCTATCTCAGGTTTTGATCTGTCGAAATGAGGCCGAAAAGTGCTTGATAGAAACATCCATTAACTCATTGCGTATAAGCCTCAAGGTAAAGCAGGCAGATGAACTTGAAAATATACTAACCAAAAAATTTCTTAGATTTTTGTCGATGAGGGCTGAAGCATTTCAGGTGCTGAGGAGAAAGCCTGTACAGGGTTATGACATTAGTTTCCTTGTTACTAATTATCATTGTGAGGAGATGCAAAAGAACAAGCTTATAGATTTCATCGTGCAATTCATGGAGGATATCGATAAAGAAATAAGCGAATTGAAACTGTCTGTGAACACCCGAGGGAGGCTCGTCGCGACTGAGTTTCTGAAGCAATTCATCTGA

Network for GWHGAAZE021434

Network category	Network	Top300 PCC genelist
Coexpression Positive	Network	Top300 PCC genelist
Coexpression Negative	Network	Top300 PCC genelist

Functional Module

Module ID	Function Annotation

Protein Structure

Pfam accession	Pfam name	Alignment start	Alignment end	E-value
PF05856.13	ARPC4	43	162	3.00E-55

Protein Sequence

Gene family

Gene family	subfamily
--	--

KEGG pathway

KO	Enzyme	pathway	mapID
K05755	ARPC4	Endocytosis	map04144
		Regulation of actin cytoskeleton	map04810
		Fc gamma R-mediated phagocytosis	map04666

Gene Ontology

GO term	Ontology	Name
GO:0030041	biological_process	actin filament polymerization
GO:0030833	biological_process	regulation of actin filament polymerization
GO:0034314	biological_process	Arp2/3 complex-mediated actin nucleation
GO:0005885	cellular_component	Arp2/3 protein complex
GO:0015629	cellular_component	actin cytoskeleton

Expression pattern

Expression pattern detail

SRP	Sample	Description	TPM
SRP075780	SRR3591705	youngest leaf	27.683
	SRR3591706	second leaf	11.403
	SRR3591707	mature leaf	5.058
	SRR3591708	Shoot apex	15.175
	SRR3591709	Stem	22.514
	SRR3591710	White floral bud	16.250
	SRR3591711	White flower	19.605
	SRR3591712	Green floral bud	17.568
	SRR3591713	Yellow flower	19.240
SRP173429	SRR8316895	Juvenile bud stage	10.604
	SRR8316896	Juvenile bud stage	16.940
	SRR8316897	Juvenile bud stage	6.967
	SRR8316894	Third green stage	6.624
	SRR8316900	Third green stage	21.838
	SRR8316901	Third green stage	18.030
	SRR8316898	Complete white stage	10.715
	SRR8316899	Complete white stage	29.187
	SRR8316903	Complete white stage	15.206
	SRR8316902	Silver flowering stage	10.441
	SRR8316904	Silver flowering stage	13.087
	SRR8316905	Silver flowering stage	5.307
	SRR8316906	Gold flowering stage	24.024
	SRR8316907	Gold flowering stage	23.182
	SRR8316908	Gold flowering stage	25.222
SRP132670	SRR6706286	Control	7.954
	SRR6706287	Light intensity 50%	7.487
	SRR6706288	Light intensity 20%	9.328
CNP0000432	CNS0095592	Slightly white alabastrum(diploid) 1	22.726
	CNS0095593	Slightly white alabastrum(diploid) 2	25.580
	CNS0095594	Slightly white alabastrum(diploid) 3	21.775
	CNS0095595	Whole white alabastrum(diploid) 2	21.610
	CNS0095596	Whole white alabastrum(diploid) 3	21.861
	CNS0095597	Whole white alabastrum(diploid) 4	24.434
	CNS0095598	Silvery flower (diploied) 1	16.492
	CNS0095599	Silvery flower (diploied) 2	18.454
	CNS0095600	Silvery flower (diploied) 3	24.551
	CNS0095601	Golden flower (diploid) 1	14.607
	CNS0095602	Golden flower (diploid) 2	17.614
	CNS0095603	Golden flower (diploid) 3	17.163
	CNS0095604	Slightly white alabastrum(tetraploid) 1	19.788
	CNS0095605	Slightly white alabastrum(tetraploid) 2	16.228
	CNS0095606	Slightly white alabastrum(tetraploid) 3	22.760
	CNS0095607	Whole white alabastrum(tetraploid) 1	19.697
	CNS0095608	Whole white alabastrum(tetraploid) 2	20.928
	CNS0095609	Whole white alabastrum(tetraploid) 3	23.751
	CNS0095610	Silvery flower (diploied) 1	23.702
	CNS0095611	Silvery flower (diploied) 2	21.302
	CNS0095612	Silvery flower (diploied) 3	26.210
	CNS0095613	Golden flower (tetraploid) 1	19.752
	CNS0095614	Golden flower (tetraploid) 2	21.468
	CNS0095615	Golden flower (tetraploid) 3	23.995
CRA001975	CRR073297	Stem 1	4.000
	CRR073298	Stem 2	5.294
	CRR073299	Stem 3	5.465
	CRR073300	Leaf 1	5.637
	CRR073301	Leaf 2	4.304
	CRR073302	Leaf 3	4.524
	CRR073303	Juvenile bud 1	5.566
	CRR073304	Juvenile bud 2	3.869
	CRR073305	Juvenile bud 3	2.632
	CRR073306	Third green 1	1.822
	CRR073307	Third green 2	2.332
	CRR073308	Third green 3	2.253
	CRR073309	Second white 1	2.940
	CRR073310	Second white 2	4.500
	CRR073311	Second white 3	2.549
	CRR073312	Silver flowering 1	2.987
	CRR073313	Silver flowering 2	3.135
	CRR073314	Silver flowering 3	1.650
	CRR073315	Gold flowering 1	3.235
	CRR073316	Gold flowering 2	3.716
	CRR073317	Gold flowering 3	2.458
	CRR073318	Tawny withering 1	4.980
	CRR073319	Tawny withering 2	10.875
	CRR073320	Tawny withering 3	11.405