Gene detail

Detail information of GWHGAAZE021579

Functional Annotation

Database	Orthologs	E value	Annotation
Nr	XP_009590741.1	1.63107E-37	PREDICTED: probable serine/threonine-protein kinase Cx32, chloroplastic isoform X2 [Nicotiana tomentosiformis]
Swissprot	tr\|O49839\|APK2A_ARATH	6E-29	Protein kinase 2A, chloroplastic (Precursor)
trEMBL	tr\|D7UDA4\|D7UDA4_VITVI	7E-36	Putative uncharacterized protein {ECO:0000313\|EMBL:CBI40719.3}
TAIR10	AT1G14370.1	2E-17	protein kinase 2A

Location And Transcript Sequence (JBrowse)

Scaffold	Type	Start	End	Strand
GWHAAZE00000006	gene	57277648	57278157	-
GWHAAZE00000006	mRNA	57277648	57278157	-
GWHAAZE00000006	exon	57277648	57278157	-
GWHAAZE00000006	CDS	57277648	57278157	-

Transcript Sequence
>GWHTAAZE021603 ATGCACTATAATTGGTCAGGATGTTTGTATCTGAAAAGTGATGTCTACGGTTTTGGAGTGGTGTTGCTGGAATTACTAACAGGTTTGAGGGTGCTTGATATGAGTAGGGGCCCCCAAAAAAATAATTTGGTGGAATGGGCCAAGCCTTTGCTGCCTCAAGGAAGAATGCTGACGAGAGTAGTGGATCCAAGACTGGGAAATGATTACCCTCGACGAGAAGCCTTCAAATTGGCTAATCTTATACGACAATGTCTTCAAAATGACCCCAAATCCCGGCCTTCAATGAACGAAGTATTTCAGAGTTTAGAACAATTTAAATCCATCAAGAAGGGTAACTCGAAAGTGGAGGAGGCTCAGGCTAGGCATCCTGCGGCTCAAGGAGAGATGACACCCGACAGGAATACAGTTCAAAGAGAGGTGACACCCGATAGGAATACAGTTCAAAGAGAGGTGACTCCCTACAAATTCCTGTGGTCATGGACTCGTTGTTTGTGGGGAAGCAATTCATAG

Network for GWHGAAZE021579

Network category	Network	Top300 PCC genelist
Coexpression Positive	Network	Top300 PCC genelist
Coexpression Negative	Network	Top300 PCC genelist

Functional Module

Module ID	Function Annotation

Protein Structure

Pfam accession	Pfam name	Alignment start	Alignment end	E-value
PF07714.18	PK_Tyr_Ser-Thr	10	102	1.90E-06

Protein Sequence

Gene family

Gene family	subfamily
Protein Kinases Family	RLK-Pelle_RLCK-VIIa-2

KEGG pathway

KO	Enzyme	pathway	mapID
--	--	--	--

Gene Ontology

GO term	Ontology	Name
GO:0006468	biological_process	protein phosphorylation
GO:0004672	molecular_function	protein kinase activity
GO:0005524	molecular_function	ATP binding

Expression pattern

Expression pattern detail

SRP	Sample	Description	TPM
SRP075780	SRR3591705	youngest leaf	10.498
	SRR3591706	second leaf	3.861
	SRR3591707	mature leaf	6.286
	SRR3591708	Shoot apex	9.770
	SRR3591709	Stem	16.875
	SRR3591710	White floral bud	6.320
	SRR3591711	White flower	6.480
	SRR3591712	Green floral bud	4.338
	SRR3591713	Yellow flower	11.280
SRP173429	SRR8316895	Juvenile bud stage	1.751
	SRR8316896	Juvenile bud stage	3.554
	SRR8316897	Juvenile bud stage	2.310
	SRR8316894	Third green stage	1.613
	SRR8316900	Third green stage	4.648
	SRR8316901	Third green stage	3.525
	SRR8316898	Complete white stage	1.752
	SRR8316899	Complete white stage	4.814
	SRR8316903	Complete white stage	5.480
	SRR8316902	Silver flowering stage	4.886
	SRR8316904	Silver flowering stage	4.277
	SRR8316905	Silver flowering stage	2.389
	SRR8316906	Gold flowering stage	8.165
	SRR8316907	Gold flowering stage	6.049
	SRR8316908	Gold flowering stage	11.133
SRP132670	SRR6706286	Control	4.583
	SRR6706287	Light intensity 50%	4.286
	SRR6706288	Light intensity 20%	3.826
CNP0000432	CNS0095592	Slightly white alabastrum(diploid) 1	2.108
	CNS0095593	Slightly white alabastrum(diploid) 2	3.131
	CNS0095594	Slightly white alabastrum(diploid) 3	4.069
	CNS0095595	Whole white alabastrum(diploid) 2	2.295
	CNS0095596	Whole white alabastrum(diploid) 3	2.359
	CNS0095597	Whole white alabastrum(diploid) 4	2.638
	CNS0095598	Silvery flower (diploied) 1	6.358
	CNS0095599	Silvery flower (diploied) 2	3.802
	CNS0095600	Silvery flower (diploied) 3	4.183
	CNS0095601	Golden flower (diploid) 1	3.149
	CNS0095602	Golden flower (diploid) 2	4.717
	CNS0095603	Golden flower (diploid) 3	5.858
	CNS0095604	Slightly white alabastrum(tetraploid) 1	6.298
	CNS0095605	Slightly white alabastrum(tetraploid) 2	7.239
	CNS0095606	Slightly white alabastrum(tetraploid) 3	13.078
	CNS0095607	Whole white alabastrum(tetraploid) 1	6.292
	CNS0095608	Whole white alabastrum(tetraploid) 2	4.256
	CNS0095609	Whole white alabastrum(tetraploid) 3	7.690
	CNS0095610	Silvery flower (diploied) 1	14.333
	CNS0095611	Silvery flower (diploied) 2	14.127
	CNS0095612	Silvery flower (diploied) 3	19.019
	CNS0095613	Golden flower (tetraploid) 1	16.125
	CNS0095614	Golden flower (tetraploid) 2	20.156
	CNS0095615	Golden flower (tetraploid) 3	20.401
CRA001975	CRR073297	Stem 1	4.689
	CRR073298	Stem 2	5.459
	CRR073299	Stem 3	3.304
	CRR073300	Leaf 1	7.168
	CRR073301	Leaf 2	7.783
	CRR073302	Leaf 3	3.074
	CRR073303	Juvenile bud 1	6.951
	CRR073304	Juvenile bud 2	3.802
	CRR073305	Juvenile bud 3	5.432
	CRR073306	Third green 1	5.338
	CRR073307	Third green 2	4.218
	CRR073308	Third green 3	5.890
	CRR073309	Second white 1	3.732
	CRR073310	Second white 2	5.812
	CRR073311	Second white 3	4.124
	CRR073312	Silver flowering 1	1.758
	CRR073313	Silver flowering 2	1.732
	CRR073314	Silver flowering 3	3.041
	CRR073315	Gold flowering 1	2.355
	CRR073316	Gold flowering 2	1.774
	CRR073317	Gold flowering 3	0.811
	CRR073318	Tawny withering 1	9.939
	CRR073319	Tawny withering 2	8.076
	CRR073320	Tawny withering 3	3.606