Gene detail

Detail information of GWHGAAZE021612

Functional Annotation

Database	Orthologs	E value	Annotation
Nr	CDO97478.1	6.7884E-123	unnamed protein product [Coffea canephora]
COG	YP_005071928.1	2E-14	serine/threonine protein kinase containing TPR domain
Swissprot	tr\|Q94F62\|BAK1_ARATH	2E-115	BRASSINOSTEROID INSENSITIVE 1-associated receptor kinase 1 (Precursor)
trEMBL	tr\|A0A068TQ37\|A0A068TQ37_COFCA	3E-123	Coffea canephora DH200=94 genomic scaffold, scaffold_1 {ECO:0000313\|EMBL:CDO97478.1}
TAIR10	AT4G33430.1	7E-96	BRI1-associated receptor kinase

Location And Transcript Sequence (JBrowse)

Scaffold	Type	Start	End	Strand
GWHAAZE00000006	gene	57937941	57939436	-
GWHAAZE00000006	mRNA	57937941	57939436	-
GWHAAZE00000006	exon	57939011	57939436	-
GWHAAZE00000006	exon	57937941	57938276	-
GWHAAZE00000006	five_prime_UTR	57939344	57939436	-
GWHAAZE00000006	CDS	57939011	57939343	-
GWHAAZE00000006	CDS	57937941	57938276	-

Transcript Sequence
>GWHTAAZE021636 GATAATTGACATGATAATATGATATTACAGAGCGACCAGAAAGCATAACCCCCACTTGATTGGCTGACAAGGAAGCAAATTGCACTGGGATCCATGAGGGGTATAATGTATTTGCATGATCATTGTGACCCCAAGATCATTCACAGAGACATTAAAGCTGCAAACATACTTTTGGATAAGGAGTTTGAAGCAGTTGTTGGAGACTTTGGGTTGGCTAAGCTGATGGACTACAAGGATACGCATGTTACCACGGCCGTGCGTGGCACAATTGGACATATACCTCCTGAGTACCTTTCCACTGGAAAAACTTCCGAGAAAAGCGATGTTTTCGGGTATGGGGTTATGCTGCTTGAGCTCATAACTGGACAGAGGGCTTTCGATCTTGTTCGGCTTGCCAATGATGATGATGTCATGTTGCTTGATTGGGTGAAAGGACTTATGGAGGAAAAGAAGTTAGAAACATTGGTGGACGCGGATCTGAACGGTTGCTACAGTGATGACGAGGTAGAGCAGCTCATCCAGGTGGCTCTGCTCTGCACCCAATGCTCCCCGACCGACCGACCCAAGATGTCAGAGGTTGTCAGAATGCTCGAAGGCGATGGTTTGTCCATGAGGTGGGAAGAGTTGCAAAACGATTTAGTTTTCCAACAAGAGTTCAACAACGCCCTCTACCCCAACAATGCCCTCTACCCCAACGCTGATTGGAACATTGCCAACTCCACCTCCTACCTCTGGCCCGATGAATTGTCTGGCCCCAGATAA

Network for GWHGAAZE021612

Network category	Network	Top300 PCC genelist
Coexpression Positive	Network	Top300 PCC genelist
Coexpression Negative	Network	Top300 PCC genelist

Functional Module

Module ID	Function Annotation

Protein Structure

Pfam accession	Pfam name	Alignment start	Alignment end	E-value
PF00069.26	Pkinase	1	164	7.60E-25

Protein Sequence

Gene family

Gene family	subfamily
Protein Kinases Family	RLK-Pelle_LRR-II

KEGG pathway

KO	Enzyme	pathway	mapID
K13416	BAK1	MAPK signaling pathway - plant	map04016
		Plant hormone signal transduction	map04075
		Plant-pathogen interaction	map04626

Gene Ontology

GO term	Ontology	Name
GO:0006468	biological_process	protein phosphorylation
GO:0004672	molecular_function	protein kinase activity
GO:0005524	molecular_function	ATP binding

Expression pattern

Expression pattern detail

SRP	Sample	Description	TPM
SRP075780	SRR3591705	youngest leaf	2.748
	SRR3591706	second leaf	0.401
	SRR3591707	mature leaf	0.217
	SRR3591708	Shoot apex	3.638
	SRR3591709	Stem	4.883
	SRR3591710	White floral bud	0.258
	SRR3591711	White flower	0.841
	SRR3591712	Green floral bud	0.517
	SRR3591713	Yellow flower	0.457
SRP173429	SRR8316895	Juvenile bud stage	46.446
	SRR8316896	Juvenile bud stage	37.683
	SRR8316897	Juvenile bud stage	1.813
	SRR8316894	Third green stage	4.249
	SRR8316900	Third green stage	10.265
	SRR8316901	Third green stage	23.905
	SRR8316898	Complete white stage	1.109
	SRR8316899	Complete white stage	33.587
	SRR8316903	Complete white stage	1.463
	SRR8316902	Silver flowering stage	2.841
	SRR8316904	Silver flowering stage	2.011
	SRR8316905	Silver flowering stage	1.264
	SRR8316906	Gold flowering stage	4.065
	SRR8316907	Gold flowering stage	3.163
	SRR8316908	Gold flowering stage	2.180
SRP132670	SRR6706286	Control	4.228
	SRR6706287	Light intensity 50%	4.727
	SRR6706288	Light intensity 20%	4.909
CNP0000432	CNS0095592	Slightly white alabastrum(diploid) 1	31.950
	CNS0095593	Slightly white alabastrum(diploid) 2	46.001
	CNS0095594	Slightly white alabastrum(diploid) 3	42.044
	CNS0095595	Whole white alabastrum(diploid) 2	26.626
	CNS0095596	Whole white alabastrum(diploid) 3	8.037
	CNS0095597	Whole white alabastrum(diploid) 4	20.793
	CNS0095598	Silvery flower (diploied) 1	41.745
	CNS0095599	Silvery flower (diploied) 2	33.820
	CNS0095600	Silvery flower (diploied) 3	19.371
	CNS0095601	Golden flower (diploid) 1	46.612
	CNS0095602	Golden flower (diploid) 2	34.864
	CNS0095603	Golden flower (diploid) 3	37.156
	CNS0095604	Slightly white alabastrum(tetraploid) 1	2.095
	CNS0095605	Slightly white alabastrum(tetraploid) 2	1.203
	CNS0095606	Slightly white alabastrum(tetraploid) 3	1.993
	CNS0095607	Whole white alabastrum(tetraploid) 1	1.646
	CNS0095608	Whole white alabastrum(tetraploid) 2	1.141
	CNS0095609	Whole white alabastrum(tetraploid) 3	2.105
	CNS0095610	Silvery flower (diploied) 1	2.828
	CNS0095611	Silvery flower (diploied) 2	1.752
	CNS0095612	Silvery flower (diploied) 3	3.570
	CNS0095613	Golden flower (tetraploid) 1	0.648
	CNS0095614	Golden flower (tetraploid) 2	1.833
	CNS0095615	Golden flower (tetraploid) 3	0.813
CRA001975	CRR073297	Stem 1	18.051
	CRR073298	Stem 2	13.610
	CRR073299	Stem 3	10.446
	CRR073300	Leaf 1	18.016
	CRR073301	Leaf 2	29.782
	CRR073302	Leaf 3	7.496
	CRR073303	Juvenile bud 1	7.357
	CRR073304	Juvenile bud 2	11.468
	CRR073305	Juvenile bud 3	17.249
	CRR073306	Third green 1	6.999
	CRR073307	Third green 2	3.951
	CRR073308	Third green 3	3.734
	CRR073309	Second white 1	3.893
	CRR073310	Second white 2	5.814
	CRR073311	Second white 3	4.933
	CRR073312	Silver flowering 1	20.945
	CRR073313	Silver flowering 2	16.890
	CRR073314	Silver flowering 3	12.007
	CRR073315	Gold flowering 1	10.609
	CRR073316	Gold flowering 2	12.745
	CRR073317	Gold flowering 3	8.805
	CRR073318	Tawny withering 1	22.825
	CRR073319	Tawny withering 2	43.515
	CRR073320	Tawny withering 3	32.349