Gene detail

Detail information of GWHGAAZE022253

Functional Annotation

Database	Orthologs	E value	Annotation
Nr	XP_011100749.1	4.21309E-45	PREDICTED: squidulin [Sesamum indicum]
Swissprot	tr\|P13868\|CALM1_SOLTU	4E-11	Calmodulin-1
trEMBL	tr\|F6H718\|F6H718_VITVI	2E-37	Putative uncharacterized protein {ECO:0000313\|EMBL:CCB47965.1}
TAIR10	AT5G49480.1	1E-23	Ca2+-binding protein 1

Location And Transcript Sequence (JBrowse)

Scaffold	Type	Start	End	Strand
GWHAAZE00000006	gene	69224562	69224846	+
GWHAAZE00000006	mRNA	69224562	69224846	+
GWHAAZE00000006	exon	69224562	69224846	+
GWHAAZE00000006	CDS	69224562	69224846	+

Transcript Sequence
>GWHTAAZE022281 ATGATATCGCACGCTGATTTTAACAAGAACGGGTACGTGGAGTACGATGAATTCGAGAAGGTACTGGGGAAGAGGAAGGGGGAGATTGGGGTAATGGAGGAGGCTTTTAGGGTTATGGATAGAGATGGGGATGGTAAAGTGGGCCATAGTGACCTCAAGAGTTATTTGGGTTGGGCTGGGTTTGATGCTACTGATGATGACATTAAGGCTATGATTAGATTGGGAGGCGGTGATGAAAATGGAGGCGTTACCTATCACGGTTTTCTCAAGATTTTATCGGTTTGA

Network for GWHGAAZE022253

Network category	Network	Top300 PCC genelist
Coexpression Positive	Network	Top300 PCC genelist
Coexpression Negative	Network	Top300 PCC genelist

Functional Module

Module ID	Function Annotation

Protein Structure

Pfam accession	Pfam name	Alignment start	Alignment end	E-value
PF13833.7	EF-hand_8	1	18	0.034
PF13202.7	EF-hand_5	33	53	0.001

Protein Sequence

Gene family

Gene family	subfamily
--	--

KEGG pathway

KO	Enzyme	pathway	mapID
K02183	CALM	Ras signaling pathway	map04014
		Rap1 signaling pathway	map04015
		MAPK signaling pathway - plant	map04016
		Apelin signaling pathway	map04371
		Calcium signaling pathway	map04020
		Phosphatidylinositol signaling system	map04070
		cAMP signaling pathway	map04024
		cGMP-PKG signaling pathway	map04022
		Oocyte meiosis	map04114
		Cellular senescence	map04218
		C-type lectin receptor signaling pathway	map04625
		Insulin signaling pathway	map04910
		Glucagon signaling pathway	map04922
		GnRH signaling pathway	map04912
		Estrogen signaling pathway	map04915
		Oxytocin signaling pathway	map04921
		Melanogenesis	map04916
		Renin secretion	map04924
		Aldosterone synthesis and secretion	map04925
		Adrenergic signaling in cardiomyocytes	map04261
		Vascular smooth muscle contraction	map04270
		Salivary secretion	map04970
		Gastric acid secretion	map04971
		Dopaminergic synapse	map04728
		Long-term potentiation	map04720
		Neurotrophin signaling pathway	map04722
		Phototransduction	map04744
		Phototransduction - fly	map04745
		Olfactory transduction	map04740
		Inflammatory mediator regulation of TRP channels	map04750
		Circadian entrainment	map04713
		Plant-pathogen interaction	map04626

Gene Ontology

GO term	Ontology	Name
GO:0005509	molecular_function	calcium ion binding

Expression pattern

Expression pattern detail

SRP	Sample	Description	TPM
SRP075780	SRR3591705	youngest leaf	55.773
	SRR3591706	second leaf	112.766
	SRR3591707	mature leaf	91.349
	SRR3591708	Shoot apex	55.888
	SRR3591709	Stem	127.018
	SRR3591710	White floral bud	117.177
	SRR3591711	White flower	108.667
	SRR3591712	Green floral bud	100.257
	SRR3591713	Yellow flower	74.517
SRP173429	SRR8316895	Juvenile bud stage	52.183
	SRR8316896	Juvenile bud stage	63.785
	SRR8316897	Juvenile bud stage	35.007
	SRR8316894	Third green stage	26.354
	SRR8316900	Third green stage	120.243
	SRR8316901	Third green stage	161.281
	SRR8316898	Complete white stage	38.126
	SRR8316899	Complete white stage	205.727
	SRR8316903	Complete white stage	68.007
	SRR8316902	Silver flowering stage	130.289
	SRR8316904	Silver flowering stage	121.210
	SRR8316905	Silver flowering stage	86.591
	SRR8316906	Gold flowering stage	285.169
	SRR8316907	Gold flowering stage	255.667
	SRR8316908	Gold flowering stage	346.481
SRP132670	SRR6706286	Control	155.576
	SRR6706287	Light intensity 50%	186.748
	SRR6706288	Light intensity 20%	156.803
CNP0000432	CNS0095592	Slightly white alabastrum(diploid) 1	164.136
	CNS0095593	Slightly white alabastrum(diploid) 2	420.866
	CNS0095594	Slightly white alabastrum(diploid) 3	279.445
	CNS0095595	Whole white alabastrum(diploid) 2	287.592
	CNS0095596	Whole white alabastrum(diploid) 3	112.133
	CNS0095597	Whole white alabastrum(diploid) 4	238.748
	CNS0095598	Silvery flower (diploied) 1	112.933
	CNS0095599	Silvery flower (diploied) 2	147.579
	CNS0095600	Silvery flower (diploied) 3	39.366
	CNS0095601	Golden flower (diploid) 1	139.354
	CNS0095602	Golden flower (diploid) 2	75.387
	CNS0095603	Golden flower (diploid) 3	69.926
	CNS0095604	Slightly white alabastrum(tetraploid) 1	34.704
	CNS0095605	Slightly white alabastrum(tetraploid) 2	38.522
	CNS0095606	Slightly white alabastrum(tetraploid) 3	40.974
	CNS0095607	Whole white alabastrum(tetraploid) 1	73.592
	CNS0095608	Whole white alabastrum(tetraploid) 2	82.760
	CNS0095609	Whole white alabastrum(tetraploid) 3	52.555
	CNS0095610	Silvery flower (diploied) 1	52.320
	CNS0095611	Silvery flower (diploied) 2	9.512
	CNS0095612	Silvery flower (diploied) 3	35.817
	CNS0095613	Golden flower (tetraploid) 1	107.670
	CNS0095614	Golden flower (tetraploid) 2	79.186
	CNS0095615	Golden flower (tetraploid) 3	25.297
CRA001975	CRR073297	Stem 1	41.197
	CRR073298	Stem 2	38.775
	CRR073299	Stem 3	30.469
	CRR073300	Leaf 1	139.204
	CRR073301	Leaf 2	140.316
	CRR073302	Leaf 3	99.138
	CRR073303	Juvenile bud 1	117.590
	CRR073304	Juvenile bud 2	158.204
	CRR073305	Juvenile bud 3	116.365
	CRR073306	Third green 1	662.948
	CRR073307	Third green 2	795.650
	CRR073308	Third green 3	577.372
	CRR073309	Second white 1	456.444
	CRR073310	Second white 2	430.011
	CRR073311	Second white 3	230.539
	CRR073312	Silver flowering 1	266.609
	CRR073313	Silver flowering 2	316.115
	CRR073314	Silver flowering 3	214.384
	CRR073315	Gold flowering 1	95.801
	CRR073316	Gold flowering 2	120.410
	CRR073317	Gold flowering 3	83.699
	CRR073318	Tawny withering 1	63.363
	CRR073319	Tawny withering 2	215.192
	CRR073320	Tawny withering 3	51.041