Gene detail

Detail information of GWHGAAZE022322

Functional Annotation

Database	Orthologs	E value	Annotation
Nr	XP_009359819.1	2.02542E-43	PREDICTED: auxin-responsive protein IAA31-like [Pyrus x bretschneideri]
Swissprot	tr\|O24410\|IAA20_ARATH	2E-32	Auxin-responsive protein IAA20
trEMBL	tr\|I1LYD6\|I1LYD6_SOYBN	8E-40	Auxin-induced protein {ECO:0000256\|RuleBase:RU004549}
TAIR10	AT2G46990.1	1E-26	indole-3-acetic acid inducible 20

Location And Transcript Sequence (JBrowse)

Scaffold	Type	Start	End	Strand
GWHAAZE00000006	gene	70443843	70444645	-
GWHAAZE00000006	mRNA	70443843	70444645	-
GWHAAZE00000006	exon	70444258	70444645	-
GWHAAZE00000006	exon	70444027	70444111	-
GWHAAZE00000006	exon	70443843	70443897	-
GWHAAZE00000006	CDS	70444258	70444645	-
GWHAAZE00000006	CDS	70444027	70444111	-
GWHAAZE00000006	CDS	70443843	70443897	-

Transcript Sequence
>GWHTAAZE022352 CCAACAACAAAAGATTTGAGCACCGATCTCAGGCTCGGACTCAGTATCTCTCCTCCTTCCCAACCTGACTTCTCTTCCTCTTCTACCTCAACCCCAAGGTATATATATATATATATATATATTTATCATTCACATTTCATCAAACATCTGACTTACTTGCACAGAAACTTTATTAATTTCAAAATAATTATATATATATATATATATTGTTGGGTTGGGATTTGTAGGGAAAGCAGAGTTGCTGACGAGAAGCGTAATAGCGATGGGTTCTTCGTGAAAGTTAACCTGGAAGGTGTTCCCATTGGGAGGAAACTCGATCTCTTTGCTGTTAATGATTATGATGAGTTGATCAAGACCCTTGGCCGTATGTTCACCACCACCTTGCTCTATCAAGTTAATTCGGACAACTATTATGTGTTGACATATGAAGACAAGGAAGGGGATTGGATGATGGTTGGTGATGTTCCATGGGAGATGTTCTTGACTACTGTGAAGAGACTGAAGATCACCAAAGCCGATAGATGCTAG

Network for GWHGAAZE022322

Network category	Network	Top300 PCC genelist
Coexpression Positive	Network	Top300 PCC genelist
Coexpression Negative	Network	Top300 PCC genelist

Functional Module

Module ID	Function Annotation

Protein Structure

Pfam accession	Pfam name	Alignment start	Alignment end	E-value
PF02309.17	AUX_IAA	83	134	2.10E-11
PF02309.17	AUX_IAA	135	172	9.00E-19

Protein Sequence

Gene family

Gene family	subfamily
Transcription Factors Family	AUX/IAA

KEGG pathway

KO	Enzyme	pathway	mapID
K14484	IAA	Plant hormone signal transduction	map04075

Gene Ontology

GO term	Ontology	Name
GO:0005515	molecular_function	protein binding

Expression pattern

Expression pattern detail

SRP	Sample	Description	TPM
SRP075780	SRR3591705	youngest leaf	0.000
	SRR3591706	second leaf	0.000
	SRR3591707	mature leaf	0.000
	SRR3591708	Shoot apex	1.880
	SRR3591709	Stem	0.934
	SRR3591710	White floral bud	0.181
	SRR3591711	White flower	0.000
	SRR3591712	Green floral bud	0.091
	SRR3591713	Yellow flower	0.000
SRP173429	SRR8316895	Juvenile bud stage	0.101
	SRR8316896	Juvenile bud stage	0.195
	SRR8316897	Juvenile bud stage	0.000
	SRR8316894	Third green stage	0.000
	SRR8316900	Third green stage	0.000
	SRR8316901	Third green stage	0.000
	SRR8316898	Complete white stage	0.000
	SRR8316899	Complete white stage	0.000
	SRR8316903	Complete white stage	0.000
	SRR8316902	Silver flowering stage	0.000
	SRR8316904	Silver flowering stage	0.000
	SRR8316905	Silver flowering stage	0.000
	SRR8316906	Gold flowering stage	0.000
	SRR8316907	Gold flowering stage	0.000
	SRR8316908	Gold flowering stage	0.007
SRP132670	SRR6706286	Control	0.000
	SRR6706287	Light intensity 50%	0.045
	SRR6706288	Light intensity 20%	0.066
CNP0000432	CNS0095592	Slightly white alabastrum(diploid) 1	0.332
	CNS0095593	Slightly white alabastrum(diploid) 2	0.050
	CNS0095594	Slightly white alabastrum(diploid) 3	0.150
	CNS0095595	Whole white alabastrum(diploid) 2	0.277
	CNS0095596	Whole white alabastrum(diploid) 3	0.000
	CNS0095597	Whole white alabastrum(diploid) 4	0.473
	CNS0095598	Silvery flower (diploied) 1	0.157
	CNS0095599	Silvery flower (diploied) 2	0.461
	CNS0095600	Silvery flower (diploied) 3	0.000
	CNS0095601	Golden flower (diploid) 1	0.000
	CNS0095602	Golden flower (diploid) 2	0.070
	CNS0095603	Golden flower (diploid) 3	0.068
	CNS0095604	Slightly white alabastrum(tetraploid) 1	0.410
	CNS0095605	Slightly white alabastrum(tetraploid) 2	0.114
	CNS0095606	Slightly white alabastrum(tetraploid) 3	1.253
	CNS0095607	Whole white alabastrum(tetraploid) 1	0.000
	CNS0095608	Whole white alabastrum(tetraploid) 2	0.000
	CNS0095609	Whole white alabastrum(tetraploid) 3	0.000
	CNS0095610	Silvery flower (diploied) 1	0.480
	CNS0095611	Silvery flower (diploied) 2	0.074
	CNS0095612	Silvery flower (diploied) 3	0.107
	CNS0095613	Golden flower (tetraploid) 1	0.000
	CNS0095614	Golden flower (tetraploid) 2	0.000
	CNS0095615	Golden flower (tetraploid) 3	0.026
CRA001975	CRR073297	Stem 1	0.257
	CRR073298	Stem 2	0.000
	CRR073299	Stem 3	0.147
	CRR073300	Leaf 1	0.000
	CRR073301	Leaf 2	0.076
	CRR073302	Leaf 3	0.696
	CRR073303	Juvenile bud 1	0.000
	CRR073304	Juvenile bud 2	0.065
	CRR073305	Juvenile bud 3	0.000
	CRR073306	Third green 1	0.000
	CRR073307	Third green 2	0.000
	CRR073308	Third green 3	0.000
	CRR073309	Second white 1	0.000
	CRR073310	Second white 2	0.000
	CRR073311	Second white 3	0.000
	CRR073312	Silver flowering 1	0.000
	CRR073313	Silver flowering 2	0.000
	CRR073314	Silver flowering 3	0.000
	CRR073315	Gold flowering 1	0.000
	CRR073316	Gold flowering 2	0.000
	CRR073317	Gold flowering 3	0.015
	CRR073318	Tawny withering 1	2.030
	CRR073319	Tawny withering 2	4.177
	CRR073320	Tawny withering 3	0.495