Gene detail

Detail information of GWHGAAZE023071

Functional Annotation

Database	Orthologs	E value	Annotation
Nr	XP_011086824.1	2.7441E-102	PREDICTED: AP2/ERF and B3 domain-containing transcription factor At1g50680-like [Sesamum indicum]
Swissprot	tr\|Q9C688\|RAVL3_ARATH	9E-85	AP2/ERF and B3 domain-containing transcription factor At1g51120
trEMBL	tr\|A0A067F891\|A0A067F891_CITSI	2E-101	Uncharacterized protein {ECO:0000313\|EMBL:KDO59411.1}
TAIR10	AT1G51120.1	2E-69	AP2/B3 transcription factor family protein

Location And Transcript Sequence (JBrowse)

Scaffold	Type	Start	End	Strand
GWHAAZE00000006	gene	82916152	82917003	+
GWHAAZE00000006	mRNA	82916152	82917003	+
GWHAAZE00000006	exon	82916152	82917003	+
GWHAAZE00000006	CDS	82916152	82917003	+

Transcript Sequence
>GWHTAAZE023101 ATGGGTTCTATTCCGAGTTTCAAAGGGGTGGTGCCACAACAGAATGGGCGCTGGGGCGCACAAATCTATGCAAACAACCAGCGCATATGGCTTGGGACCTTCAAATCAGTGACTGATGCTGCTACGGCGTACGATTGTGCAGCCCTCAAGCTTCGCAATACAGTTGACCCCCACAGAAACTTCCCTTGGACCGACATCACTATTCATGAGTCAAACTTTCAAAGCAATTACAGCACAGAAGCAATTCTTCACATGATCAAGGACGGATCATATCCATCCAAATTTACTGATTTTATGACCCATCAAATGAGAGATCATCAAGAATGTACTCCAAAAACACCTTCCTATAGACTACTTTTCCAGAAGGCGCTAACACCAAGCGATGTTGGTAAGCTTAACAGGCTTGTAATCCCCAAGAAATTTGCTCTAAAGTACTTCCCAAATATTGGTGATGAGACCGTGGATGGTGTGGATGTGCAACTTCCTTTTTATGATAAGCTGATGAGGCTGTGGACTTTTCGATATTGTTACTGGAAGAGTAGTCAGAGTTATGTCTTCACACGGGGTTGGAATCGGTTCGTGAGGGAAAATAAATTGAAAGCAAATGATGCAGTGGCTTTTTACGTATATGAGAATCAGGAAGGGTCAAAATATGGGCAAATGTTCTGTGTTATTGATGTACAACATAATGCAGGCTCAAGCAATGTTGGCATGGTAGGTTTGGTGCAAAATGAAAACTATGGGTTGGTGAAGGAAGAGTTTGAGGATTCAAATCCTTCAGTGGGATCATCCTCCTCATCATGTGATTATGGGAAAAAAGGTTTTAAGCTATTTGGTGTTCAAATTATTTGA

Network for GWHGAAZE023071

Network category	Network	Top300 PCC genelist
Coexpression Positive	Network	Top300 PCC genelist
Coexpression Negative	Network	Top300 PCC genelist

Functional Module

Module ID	Function Annotation

Protein Structure

Pfam accession	Pfam name	Alignment start	Alignment end	E-value
PF00847.21	AP2	5	53	2.40E-06
PF02362.22	B3	120	214	3.80E-24

Protein Sequence

Gene family

Gene family	subfamily
Transcription Factors Family	B3

KEGG pathway

KO	Enzyme	pathway	mapID
--	--	--	--

Gene Ontology

GO term	Ontology	Name
GO:0006355	biological_process	regulation of transcription, DNA-templated
GO:0003700	molecular_function	DNA-binding transcription factor activity
GO:0003677	molecular_function	DNA binding

Expression pattern

Expression pattern detail

SRP	Sample	Description	TPM
SRP075780	SRR3591705	youngest leaf	0.000
	SRR3591706	second leaf	0.000
	SRR3591707	mature leaf	0.000
	SRR3591708	Shoot apex	0.000
	SRR3591709	Stem	0.000
	SRR3591710	White floral bud	1.495
	SRR3591711	White flower	1.671
	SRR3591712	Green floral bud	2.054
	SRR3591713	Yellow flower	0.462
SRP173429	SRR8316895	Juvenile bud stage	0.440
	SRR8316896	Juvenile bud stage	0.515
	SRR8316897	Juvenile bud stage	0.137
	SRR8316894	Third green stage	1.240
	SRR8316900	Third green stage	0.965
	SRR8316901	Third green stage	0.663
	SRR8316898	Complete white stage	0.430
	SRR8316899	Complete white stage	1.175
	SRR8316903	Complete white stage	0.280
	SRR8316902	Silver flowering stage	0.177
	SRR8316904	Silver flowering stage	0.692
	SRR8316905	Silver flowering stage	0.476
	SRR8316906	Gold flowering stage	0.663
	SRR8316907	Gold flowering stage	0.231
	SRR8316908	Gold flowering stage	0.901
SRP132670	SRR6706286	Control	0.502
	SRR6706287	Light intensity 50%	1.174
	SRR6706288	Light intensity 20%	1.314
CNP0000432	CNS0095592	Slightly white alabastrum(diploid) 1	0.164
	CNS0095593	Slightly white alabastrum(diploid) 2	0.404
	CNS0095594	Slightly white alabastrum(diploid) 3	0.131
	CNS0095595	Whole white alabastrum(diploid) 2	0.037
	CNS0095596	Whole white alabastrum(diploid) 3	0.434
	CNS0095597	Whole white alabastrum(diploid) 4	0.005
	CNS0095598	Silvery flower (diploied) 1	0.486
	CNS0095599	Silvery flower (diploied) 2	0.487
	CNS0095600	Silvery flower (diploied) 3	0.712
	CNS0095601	Golden flower (diploid) 1	0.006
	CNS0095602	Golden flower (diploid) 2	0.389
	CNS0095603	Golden flower (diploid) 3	0.722
	CNS0095604	Slightly white alabastrum(tetraploid) 1	0.586
	CNS0095605	Slightly white alabastrum(tetraploid) 2	0.413
	CNS0095606	Slightly white alabastrum(tetraploid) 3	0.930
	CNS0095607	Whole white alabastrum(tetraploid) 1	0.718
	CNS0095608	Whole white alabastrum(tetraploid) 2	0.850
	CNS0095609	Whole white alabastrum(tetraploid) 3	0.735
	CNS0095610	Silvery flower (diploied) 1	0.463
	CNS0095611	Silvery flower (diploied) 2	0.650
	CNS0095612	Silvery flower (diploied) 3	0.518
	CNS0095613	Golden flower (tetraploid) 1	0.302
	CNS0095614	Golden flower (tetraploid) 2	0.517
	CNS0095615	Golden flower (tetraploid) 3	0.783
CRA001975	CRR073297	Stem 1	1.558
	CRR073298	Stem 2	2.594
	CRR073299	Stem 3	0.049
	CRR073300	Leaf 1	3.075
	CRR073301	Leaf 2	1.797
	CRR073302	Leaf 3	0.424
	CRR073303	Juvenile bud 1	0.038
	CRR073304	Juvenile bud 2	0.000
	CRR073305	Juvenile bud 3	0.044
	CRR073306	Third green 1	0.000
	CRR073307	Third green 2	0.000
	CRR073308	Third green 3	0.000
	CRR073309	Second white 1	0.000
	CRR073310	Second white 2	0.116
	CRR073311	Second white 3	0.000
	CRR073312	Silver flowering 1	0.468
	CRR073313	Silver flowering 2	0.000
	CRR073314	Silver flowering 3	0.543
	CRR073315	Gold flowering 1	0.000
	CRR073316	Gold flowering 2	0.000
	CRR073317	Gold flowering 3	0.000
	CRR073318	Tawny withering 1	0.000
	CRR073319	Tawny withering 2	0.000
	CRR073320	Tawny withering 3	0.000