Gene detail

Detail information of GWHGAAZE023138

Functional Annotation

Database	Orthologs	E value	Annotation
Nr	CDP19885.1	1.32369E-40	unnamed protein product [Coffea canephora]
Swissprot	tr\|Q9SCZ4\|FERON_ARATH	4E-36	Receptor-like protein kinase FERONIA (Precursor)
trEMBL	tr\|A0A068VGC2\|A0A068VGC2_COFCA	5E-41	Coffea canephora DH200=94 genomic scaffold, scaffold_763 {ECO:0000313\|EMBL:CDP19885.1}
TAIR10	AT3G51550.1	4E-27	Malectin/receptor-like protein kinase family protein

Location And Transcript Sequence (JBrowse)

Scaffold	Type	Start	End	Strand
GWHAAZE00000007	gene	303927	304570	-
GWHAAZE00000007	mRNA	303927	304570	-
GWHAAZE00000007	exon	303927	304173	-
GWHAAZE00000007	exon	304275	304570	-
GWHAAZE00000007	CDS	304275	304570	-
GWHAAZE00000007	CDS	303927	304173	-

Transcript Sequence
>GWHTAAZE023168 ATGATTCGAAGCACAAAAATTATAATCGGTGACGAGAAGTCTACAAACAATTTGCTAGACGAAAGATTGGTGGTGAAAGTCTCCGATTTCGGTTTGTCCAAGATGGAACCTACCGGTGTGTCTCACACCCACATGAGCACCATGGTTAAGGGCCCGGAGTACTATCAACTACAAAGATTGACAGATAAGTCTGACGAGAACTCATTCGGGGTGGTGTTATTCGAAGTGCTGTCAAGTAAACCAGCAATTATTGAAGACATACCTGAGGAGCTGGTGAATTTGGCTGAGTGGGCTCGTTGCGTCCAAGAACAAGGGATCAGTAGACCATCAATGAGTGACATGGTTTGGAGTTTGGAGCTTGTATTGCAACTTCAAGAGGCTGCTGAGAATATGAGTGCGAATGGAGCTGCACTTGAGACCTTGGAAAATTTCACGAATTTGCCTTTCCATCTTAGAGAGGATGCCTCAACAGAGCATGATGAGAGCTTGTCTGGGTCGATCGAATTAGCAGGCAGCTCTGGAAGTATAGTATGTCATTATTGA

Network for GWHGAAZE023138

Network category	Network	Top300 PCC genelist
Coexpression Positive	Network	Top300 PCC genelist
Coexpression Negative	Network	Top300 PCC genelist

Functional Module

Module ID	Function Annotation

Protein Structure

Pfam accession	Pfam name	Alignment start	Alignment end	E-value
PF07714.18	PK_Tyr_Ser-Thr	5	79	1.80E-09

Protein Sequence

Gene family

Gene family	subfamily
Protein Kinases Family	RLK-Pelle_CrRLK1L-1

KEGG pathway

KO	Enzyme	pathway	mapID
--	--	--	--

Gene Ontology

GO term	Ontology	Name
GO:0006468	biological_process	protein phosphorylation
GO:0004672	molecular_function	protein kinase activity
GO:0005524	molecular_function	ATP binding

Expression pattern

Expression pattern detail

SRP	Sample	Description	TPM
SRP075780	SRR3591705	youngest leaf	0.704
	SRR3591706	second leaf	0.058
	SRR3591707	mature leaf	0.000
	SRR3591708	Shoot apex	0.661
	SRR3591709	Stem	1.374
	SRR3591710	White floral bud	6.840
	SRR3591711	White flower	8.027
	SRR3591712	Green floral bud	2.262
	SRR3591713	Yellow flower	3.928
SRP173429	SRR8316895	Juvenile bud stage	9.464
	SRR8316896	Juvenile bud stage	5.450
	SRR8316897	Juvenile bud stage	0.830
	SRR8316894	Third green stage	2.815
	SRR8316900	Third green stage	5.223
	SRR8316901	Third green stage	6.500
	SRR8316898	Complete white stage	15.226
	SRR8316899	Complete white stage	18.864
	SRR8316903	Complete white stage	27.526
	SRR8316902	Silver flowering stage	34.725
	SRR8316904	Silver flowering stage	37.037
	SRR8316905	Silver flowering stage	17.290
	SRR8316906	Gold flowering stage	28.942
	SRR8316907	Gold flowering stage	57.585
	SRR8316908	Gold flowering stage	14.837
SRP132670	SRR6706286	Control	6.069
	SRR6706287	Light intensity 50%	8.308
	SRR6706288	Light intensity 20%	6.933
CNP0000432	CNS0095592	Slightly white alabastrum(diploid) 1	10.458
	CNS0095593	Slightly white alabastrum(diploid) 2	8.025
	CNS0095594	Slightly white alabastrum(diploid) 3	13.557
	CNS0095595	Whole white alabastrum(diploid) 2	5.162
	CNS0095596	Whole white alabastrum(diploid) 3	4.696
	CNS0095597	Whole white alabastrum(diploid) 4	7.813
	CNS0095598	Silvery flower (diploied) 1	38.030
	CNS0095599	Silvery flower (diploied) 2	23.449
	CNS0095600	Silvery flower (diploied) 3	79.730
	CNS0095601	Golden flower (diploid) 1	15.785
	CNS0095602	Golden flower (diploid) 2	42.318
	CNS0095603	Golden flower (diploid) 3	37.727
	CNS0095604	Slightly white alabastrum(tetraploid) 1	0.235
	CNS0095605	Slightly white alabastrum(tetraploid) 2	0.000
	CNS0095606	Slightly white alabastrum(tetraploid) 3	0.427
	CNS0095607	Whole white alabastrum(tetraploid) 1	0.055
	CNS0095608	Whole white alabastrum(tetraploid) 2	0.000
	CNS0095609	Whole white alabastrum(tetraploid) 3	0.072
	CNS0095610	Silvery flower (diploied) 1	0.232
	CNS0095611	Silvery flower (diploied) 2	0.472
	CNS0095612	Silvery flower (diploied) 3	2.698
	CNS0095613	Golden flower (tetraploid) 1	1.343
	CNS0095614	Golden flower (tetraploid) 2	0.000
	CNS0095615	Golden flower (tetraploid) 3	0.254
CRA001975	CRR073297	Stem 1	10.932
	CRR073298	Stem 2	7.888
	CRR073299	Stem 3	10.339
	CRR073300	Leaf 1	4.791
	CRR073301	Leaf 2	6.473
	CRR073302	Leaf 3	3.911
	CRR073303	Juvenile bud 1	7.995
	CRR073304	Juvenile bud 2	2.798
	CRR073305	Juvenile bud 3	5.722
	CRR073306	Third green 1	128.304
	CRR073307	Third green 2	124.214
	CRR073308	Third green 3	121.011
	CRR073309	Second white 1	269.593
	CRR073310	Second white 2	201.309
	CRR073311	Second white 3	175.932
	CRR073312	Silver flowering 1	172.017
	CRR073313	Silver flowering 2	127.986
	CRR073314	Silver flowering 3	91.206
	CRR073315	Gold flowering 1	6.738
	CRR073316	Gold flowering 2	6.166
	CRR073317	Gold flowering 3	4.187
	CRR073318	Tawny withering 1	6.393
	CRR073319	Tawny withering 2	4.298
	CRR073320	Tawny withering 3	10.870