Gene detail

Detail information of GWHGAAZE023399

Functional Annotation

Database	Orthologs	E value	Annotation
Nr	XP_010315978.1	1.07062E-57	PREDICTED: ethylene-responsive transcription factor ERF011 [Solanum lycopersicum]
Swissprot	tr\|O22174\|ERF08_ARATH	5E-41	Ethylene-responsive transcription factor ERF008
trEMBL	tr\|K4BDA9\|K4BDA9_SOLLC	8E-59	Uncharacterized protein {ECO:0000313\|EnsemblPlants:Solyc02g093130.1.1}
TAIR10	AT2G23340.1	3E-24	DREB and EAR motif protein 3

Location And Transcript Sequence (JBrowse)

Scaffold	Type	Start	End	Strand
GWHAAZE00000007	gene	7438672	7439049	-
GWHAAZE00000007	mRNA	7438672	7439049	-
GWHAAZE00000007	exon	7438672	7439049	-
GWHAAZE00000007	CDS	7438672	7439049	-

Transcript Sequence
>GWHTAAZE023429 ATGAGAAAGTGGGGAAAGTGGGTGGCGGAGATTAGAGAACCCAACAAGCGCTCTAGGATTTGGCTCGGTTCTTACTTGACACCACTAGCGGCGGCGAGGGCTTATGATACCGCCGCTTACTACCTCCGGGGGCCGTCGGCGAGGCTCAATTTCCCCGATTTGATGGTTGGTGGAGAAACCGCCGCCGATGCTGGTGGAGGAGGAGTCAACGACTTGTCAGCAATCACTATCCGGAGGAAAGCGATAGAGGTTGGATCTAGAGTTGATGCTCTTCAAGCTACTAAGGGTGGACACGAACCATCTGAGCTGAAACCCTGTTGGTTCCAAGAGAAACCCGATTTGAATTTGAAACCCGAAGATGACCCGGATACTGATTGA

Network for GWHGAAZE023399

Network category	Network	Top300 PCC genelist
Coexpression Positive	Network	Top300 PCC genelist
Coexpression Negative	Network	Top300 PCC genelist

Functional Module

Module ID	Function Annotation

Protein Structure

Pfam accession	Pfam name	Alignment start	Alignment end	E-value
PF00847.21	AP2	2	44	2.20E-09

Protein Sequence

Gene family

Gene family	subfamily
Transcription Factors Family	AP2/ERF-ERF

KEGG pathway

KO	Enzyme	pathway	mapID
--	--	--	--

Gene Ontology

GO term	Ontology	Name
GO:0006355	biological_process	regulation of transcription, DNA-templated
GO:0003700	molecular_function	DNA-binding transcription factor activity
GO:0003677	molecular_function	DNA binding

Expression pattern

Expression pattern detail

SRP	Sample	Description	TPM
SRP075780	SRR3591705	youngest leaf	25.558
	SRR3591706	second leaf	46.089
	SRR3591707	mature leaf	48.621
	SRR3591708	Shoot apex	42.185
	SRR3591709	Stem	45.362
	SRR3591710	White floral bud	20.846
	SRR3591711	White flower	36.814
	SRR3591712	Green floral bud	23.139
	SRR3591713	Yellow flower	31.440
SRP173429	SRR8316895	Juvenile bud stage	21.956
	SRR8316896	Juvenile bud stage	29.709
	SRR8316897	Juvenile bud stage	12.327
	SRR8316894	Third green stage	7.614
	SRR8316900	Third green stage	24.257
	SRR8316901	Third green stage	23.347
	SRR8316898	Complete white stage	6.860
	SRR8316899	Complete white stage	31.846
	SRR8316903	Complete white stage	8.306
	SRR8316902	Silver flowering stage	15.928
	SRR8316904	Silver flowering stage	12.704
	SRR8316905	Silver flowering stage	3.605
	SRR8316906	Gold flowering stage	23.797
	SRR8316907	Gold flowering stage	29.501
	SRR8316908	Gold flowering stage	27.439
SRP132670	SRR6706286	Control	22.808
	SRR6706287	Light intensity 50%	21.410
	SRR6706288	Light intensity 20%	22.887
CNP0000432	CNS0095592	Slightly white alabastrum(diploid) 1	37.641
	CNS0095593	Slightly white alabastrum(diploid) 2	43.724
	CNS0095594	Slightly white alabastrum(diploid) 3	33.978
	CNS0095595	Whole white alabastrum(diploid) 2	28.604
	CNS0095596	Whole white alabastrum(diploid) 3	22.571
	CNS0095597	Whole white alabastrum(diploid) 4	23.337
	CNS0095598	Silvery flower (diploied) 1	29.747
	CNS0095599	Silvery flower (diploied) 2	25.784
	CNS0095600	Silvery flower (diploied) 3	25.152
	CNS0095601	Golden flower (diploid) 1	26.979
	CNS0095602	Golden flower (diploid) 2	30.598
	CNS0095603	Golden flower (diploid) 3	30.974
	CNS0095604	Slightly white alabastrum(tetraploid) 1	28.431
	CNS0095605	Slightly white alabastrum(tetraploid) 2	23.379
	CNS0095606	Slightly white alabastrum(tetraploid) 3	50.631
	CNS0095607	Whole white alabastrum(tetraploid) 1	17.512
	CNS0095608	Whole white alabastrum(tetraploid) 2	20.611
	CNS0095609	Whole white alabastrum(tetraploid) 3	30.264
	CNS0095610	Silvery flower (diploied) 1	29.416
	CNS0095611	Silvery flower (diploied) 2	19.935
	CNS0095612	Silvery flower (diploied) 3	33.551
	CNS0095613	Golden flower (tetraploid) 1	30.905
	CNS0095614	Golden flower (tetraploid) 2	29.997
	CNS0095615	Golden flower (tetraploid) 3	23.356
CRA001975	CRR073297	Stem 1	40.598
	CRR073298	Stem 2	36.694
	CRR073299	Stem 3	54.728
	CRR073300	Leaf 1	33.480
	CRR073301	Leaf 2	37.403
	CRR073302	Leaf 3	40.719
	CRR073303	Juvenile bud 1	25.576
	CRR073304	Juvenile bud 2	20.820
	CRR073305	Juvenile bud 3	22.336
	CRR073306	Third green 1	41.291
	CRR073307	Third green 2	36.665
	CRR073308	Third green 3	31.649
	CRR073309	Second white 1	40.656
	CRR073310	Second white 2	38.300
	CRR073311	Second white 3	26.637
	CRR073312	Silver flowering 1	30.141
	CRR073313	Silver flowering 2	34.073
	CRR073314	Silver flowering 3	35.203
	CRR073315	Gold flowering 1	259.668
	CRR073316	Gold flowering 2	192.202
	CRR073317	Gold flowering 3	111.918
	CRR073318	Tawny withering 1	87.470
	CRR073319	Tawny withering 2	96.495
	CRR073320	Tawny withering 3	50.121