Gene detail

Detail information of GWHGAAZE024042

Functional Annotation

Database	Orthologs	E value	Annotation
Nr	XP_004500566.1	1.818E-38	PREDICTED: ethylene-responsive transcription factor ERF014-like [Cicer arietinum]
Swissprot	tr\|Q9SFE4\|ERF12_ARATH	4E-36	Ethylene-responsive transcription factor ERF012
trEMBL	tr\|A9PLA6\|A9PLA6_POPTR	1E-37	RAP2-like protein {ECO:0000313\|EMBL:ABQ63000.1}
TAIR10	AT1G21910.1	4E-19	Integrase-type DNA-binding superfamily protein

Location And Transcript Sequence (JBrowse)

Scaffold	Type	Start	End	Strand
GWHAAZE00000007	gene	33779763	33780419	-
GWHAAZE00000007	mRNA	33779763	33780419	-
GWHAAZE00000007	exon	33780212	33780419	-
GWHAAZE00000007	exon	33779763	33780118	-
GWHAAZE00000007	CDS	33780212	33780419	-
GWHAAZE00000007	CDS	33779763	33780118	-

Transcript Sequence
>GWHTAAZE024076 ATGACATCAACCTCATCATCGCACAAGAAAAAGTTCAAGGGAGTGAGGATGAGAAGTTGGGGATCATATGTATCAGAAATAAGAGCACCCCATCAAAAAACAAGAATATGGCTAGGCTCTTACTCTACTCCTGAGGCAGCTGCTAGGGCCTATGATGCTGCCCTTTTATGCCTCAAGGGCCCCACAGCCAATCTCAACTTCCCCAACTCCGCTTCCCCACTATCCTCCTCCTCGTCCACATCCACGTCATCATCACCGGCATCGACGGAAGATGACGTGTCATTAACGTCCTCGCTGCCATACTCTCCATCGAGTCCAACTGAGGATGACATGTCACTAGCGTCCTCACTGGCATCCTCTCCGTTGAATCAAGTGGAGGATGTTGTGTCATTATTTTCGTCCTTTTTTGACAGTTACACGCCTAGTTTGGCACAGGATGAACCGAGTTGGTACAATTTTGATTCGCCAAAGTACGGAGATATGCCCAATGGGGTGTTTTTAGATTCGCCCGTGATTGAAGATGTTTACGAAGAAAGCGATATTCGGCTTTGGAACTTCTGTTGA

Network for GWHGAAZE024042

Network category	Network	Top300 PCC genelist
Coexpression Positive	Network	Top300 PCC genelist
Coexpression Negative	Network	Top300 PCC genelist

Functional Module

Module ID	Function Annotation

Protein Structure

Pfam accession	Pfam name	Alignment start	Alignment end	E-value
PF00847.21	AP2	11	60	2.80E-10

Protein Sequence

Gene family

Gene family	subfamily
Transcription Factors Family	AP2/ERF-ERF

KEGG pathway

KO	Enzyme	pathway	mapID
--	--	--	--

Gene Ontology

GO term	Ontology	Name
GO:0006355	biological_process	regulation of transcription, DNA-templated
GO:0003700	molecular_function	DNA-binding transcription factor activity
GO:0003677	molecular_function	DNA binding

Expression pattern

Expression pattern detail

SRP	Sample	Description	TPM
SRP075780	SRR3591705	youngest leaf	43.177
	SRR3591706	second leaf	1.954
	SRR3591707	mature leaf	0.334
	SRR3591708	Shoot apex	6.527
	SRR3591709	Stem	26.675
	SRR3591710	White floral bud	10.821
	SRR3591711	White flower	5.026
	SRR3591712	Green floral bud	13.064
	SRR3591713	Yellow flower	1.452
SRP173429	SRR8316895	Juvenile bud stage	5.659
	SRR8316896	Juvenile bud stage	5.780
	SRR8316897	Juvenile bud stage	4.358
	SRR8316894	Third green stage	4.070
	SRR8316900	Third green stage	9.256
	SRR8316901	Third green stage	15.375
	SRR8316898	Complete white stage	2.464
	SRR8316899	Complete white stage	34.349
	SRR8316903	Complete white stage	4.010
	SRR8316902	Silver flowering stage	5.327
	SRR8316904	Silver flowering stage	3.685
	SRR8316905	Silver flowering stage	1.037
	SRR8316906	Gold flowering stage	1.562
	SRR8316907	Gold flowering stage	1.710
	SRR8316908	Gold flowering stage	2.165
SRP132670	SRR6706286	Control	5.349
	SRR6706287	Light intensity 50%	4.716
	SRR6706288	Light intensity 20%	5.605
CNP0000432	CNS0095592	Slightly white alabastrum(diploid) 1	12.441
	CNS0095593	Slightly white alabastrum(diploid) 2	21.310
	CNS0095594	Slightly white alabastrum(diploid) 3	15.026
	CNS0095595	Whole white alabastrum(diploid) 2	10.043
	CNS0095596	Whole white alabastrum(diploid) 3	4.264
	CNS0095597	Whole white alabastrum(diploid) 4	10.705
	CNS0095598	Silvery flower (diploied) 1	7.760
	CNS0095599	Silvery flower (diploied) 2	6.117
	CNS0095600	Silvery flower (diploied) 3	4.372
	CNS0095601	Golden flower (diploid) 1	5.449
	CNS0095602	Golden flower (diploid) 2	4.602
	CNS0095603	Golden flower (diploid) 3	2.378
	CNS0095604	Slightly white alabastrum(tetraploid) 1	2.231
	CNS0095605	Slightly white alabastrum(tetraploid) 2	4.975
	CNS0095606	Slightly white alabastrum(tetraploid) 3	3.201
	CNS0095607	Whole white alabastrum(tetraploid) 1	6.359
	CNS0095608	Whole white alabastrum(tetraploid) 2	3.457
	CNS0095609	Whole white alabastrum(tetraploid) 3	0.927
	CNS0095610	Silvery flower (diploied) 1	0.340
	CNS0095611	Silvery flower (diploied) 2	0.160
	CNS0095612	Silvery flower (diploied) 3	1.465
	CNS0095613	Golden flower (tetraploid) 1	0.961
	CNS0095614	Golden flower (tetraploid) 2	0.097
	CNS0095615	Golden flower (tetraploid) 3	0.000
CRA001975	CRR073297	Stem 1	3.573
	CRR073298	Stem 2	2.208
	CRR073299	Stem 3	3.423
	CRR073300	Leaf 1	5.791
	CRR073301	Leaf 2	9.321
	CRR073302	Leaf 3	3.635
	CRR073303	Juvenile bud 1	8.453
	CRR073304	Juvenile bud 2	4.300
	CRR073305	Juvenile bud 3	23.996
	CRR073306	Third green 1	2.620
	CRR073307	Third green 2	4.637
	CRR073308	Third green 3	5.375
	CRR073309	Second white 1	0.000
	CRR073310	Second white 2	0.100
	CRR073311	Second white 3	0.093
	CRR073312	Silver flowering 1	0.000
	CRR073313	Silver flowering 2	0.073
	CRR073314	Silver flowering 3	0.000
	CRR073315	Gold flowering 1	11.392
	CRR073316	Gold flowering 2	20.878
	CRR073317	Gold flowering 3	5.122
	CRR073318	Tawny withering 1	26.953
	CRR073319	Tawny withering 2	62.325
	CRR073320	Tawny withering 3	65.043