Gene detail

Detail information of GWHGAAZE024530

Functional Annotation

Database	Orthologs	E value	Annotation
Nr	KDO72559.1	4.02448E-82	hypothetical protein CISIN_1g041877mg [Citrus sinensis]
Swissprot	tr\|Q8LC03\|ATB13_ARATH	3E-65	Homeobox-leucine zipper protein ATHB-13
trEMBL	tr\|A0A067FYT8\|A0A067FYT8_CITSI	2E-82	Uncharacterized protein {ECO:0000313\|EMBL:KDO72559.1}
TAIR10	AT1G69780.1	9E-54	Homeobox-leucine zipper protein family

Location And Transcript Sequence (JBrowse)

Scaffold	Type	Start	End	Strand
GWHAAZE00000007	gene	44316930	44318931	-
GWHAAZE00000007	mRNA	44316930	44318931	-
GWHAAZE00000007	exon	44316930	44317133	-
GWHAAZE00000007	exon	44318560	44318931	-
GWHAAZE00000007	CDS	44318560	44318931	-
GWHAAZE00000007	CDS	44316930	44317133	-

Transcript Sequence
>GWHTAAZE024564 ATGTTGATGAGGAGATCGATGTCGTTTTCGGGGATTAATGAGAGGTGTGATCATGAAGTGAGGGGAGATGATGACATGTCTGATGATGGATCACAGCTAGGGGAGAAGAAGAGGAGGCTGAATTTGGAGCAAGTGAAGGCACTTGAGAGGAGCTTTGAGTTGGGTAACAAGCTTGAGCCAGAGAGGAAAGTGCAGTTGGCTAGGGCATTGGGGCTTCAACCAAGGCAAGTGGCCATTTGGTTCCAAAACAGAAGGGCTAGATGGAAGACTAAGCAATTGGAGAGGGATTATGAAATATTGAAGAGACAATTTGAGTCACTTAAGGCTGATAATGATGCTCTCAAGACTCAAAACAAGAAACTTCATGGAGAGTTATTGGCTCTAAAAGGTGGAGAATCAAACAATGGAAACAGACCAATTAATCTCAACAAAGAAACAGAGGCTTCGTGGAGCAATGGAAGCGAGAATAGTTGTGATCACCTACACGCAGGTCTAACACAAGCACTTTTCCAAAGCTCATCAACACCACACGATCTCAAAATCAATCCAGCTGTTGCTGATGAAAGCTTCTGCAAC

Network for GWHGAAZE024530

Network category	Network	Top300 PCC genelist
Coexpression Positive	Network	Top300 PCC genelist
Coexpression Negative	Network	Top300 PCC genelist

Functional Module

Module ID	Function Annotation

Protein Structure

Pfam accession	Pfam name	Alignment start	Alignment end	E-value
PF00046.30	Homeodomain	36	89	1.30E-15
PF02183.19	HALZ	91	130	2.30E-16

Protein Sequence

Gene family

Gene family	subfamily
Transcription Factors Family	HB-HD-ZIP

KEGG pathway

KO	Enzyme	pathway	mapID
--	--	--	--

Gene Ontology

GO term	Ontology	Name
GO:0006355	biological_process	regulation of transcription, DNA-templated
GO:0003677	molecular_function	DNA binding
GO:0003700	molecular_function	DNA-binding transcription factor activity
GO:0043565	molecular_function	sequence-specific DNA binding

Expression pattern

Expression pattern detail

SRP	Sample	Description	TPM
SRP075780	SRR3591705	youngest leaf	13.050
	SRR3591706	second leaf	0.851
	SRR3591707	mature leaf	0.097
	SRR3591708	Shoot apex	7.511
	SRR3591709	Stem	1.000
	SRR3591710	White floral bud	83.948
	SRR3591711	White flower	20.169
	SRR3591712	Green floral bud	14.881
	SRR3591713	Yellow flower	5.699
SRP173429	SRR8316895	Juvenile bud stage	2.814
	SRR8316896	Juvenile bud stage	3.155
	SRR8316897	Juvenile bud stage	0.628
	SRR8316894	Third green stage	1.799
	SRR8316900	Third green stage	4.409
	SRR8316901	Third green stage	5.667
	SRR8316898	Complete white stage	48.131
	SRR8316899	Complete white stage	16.276
	SRR8316903	Complete white stage	62.409
	SRR8316902	Silver flowering stage	13.986
	SRR8316904	Silver flowering stage	16.832
	SRR8316905	Silver flowering stage	10.278
	SRR8316906	Gold flowering stage	14.724
	SRR8316907	Gold flowering stage	25.081
	SRR8316908	Gold flowering stage	17.073
SRP132670	SRR6706286	Control	7.840
	SRR6706287	Light intensity 50%	10.745
	SRR6706288	Light intensity 20%	11.188
CNP0000432	CNS0095592	Slightly white alabastrum(diploid) 1	2.837
	CNS0095593	Slightly white alabastrum(diploid) 2	2.160
	CNS0095594	Slightly white alabastrum(diploid) 3	3.052
	CNS0095595	Whole white alabastrum(diploid) 2	2.096
	CNS0095596	Whole white alabastrum(diploid) 3	0.576
	CNS0095597	Whole white alabastrum(diploid) 4	3.117
	CNS0095598	Silvery flower (diploied) 1	3.947
	CNS0095599	Silvery flower (diploied) 2	3.272
	CNS0095600	Silvery flower (diploied) 3	13.414
	CNS0095601	Golden flower (diploid) 1	1.784
	CNS0095602	Golden flower (diploid) 2	2.738
	CNS0095603	Golden flower (diploid) 3	3.111
	CNS0095604	Slightly white alabastrum(tetraploid) 1	4.881
	CNS0095605	Slightly white alabastrum(tetraploid) 2	3.023
	CNS0095606	Slightly white alabastrum(tetraploid) 3	9.173
	CNS0095607	Whole white alabastrum(tetraploid) 1	2.403
	CNS0095608	Whole white alabastrum(tetraploid) 2	2.091
	CNS0095609	Whole white alabastrum(tetraploid) 3	6.513
	CNS0095610	Silvery flower (diploied) 1	12.272
	CNS0095611	Silvery flower (diploied) 2	12.124
	CNS0095612	Silvery flower (diploied) 3	39.784
	CNS0095613	Golden flower (tetraploid) 1	2.776
	CNS0095614	Golden flower (tetraploid) 2	3.310
	CNS0095615	Golden flower (tetraploid) 3	2.170
CRA001975	CRR073297	Stem 1	12.205
	CRR073298	Stem 2	12.188
	CRR073299	Stem 3	9.287
	CRR073300	Leaf 1	19.033
	CRR073301	Leaf 2	13.070
	CRR073302	Leaf 3	7.161
	CRR073303	Juvenile bud 1	18.178
	CRR073304	Juvenile bud 2	25.205
	CRR073305	Juvenile bud 3	16.410
	CRR073306	Third green 1	43.996
	CRR073307	Third green 2	54.373
	CRR073308	Third green 3	51.066
	CRR073309	Second white 1	10.025
	CRR073310	Second white 2	7.320
	CRR073311	Second white 3	3.408
	CRR073312	Silver flowering 1	2.696
	CRR073313	Silver flowering 2	1.182
	CRR073314	Silver flowering 3	3.384
	CRR073315	Gold flowering 1	0.000
	CRR073316	Gold flowering 2	0.207
	CRR073317	Gold flowering 3	0.050
	CRR073318	Tawny withering 1	0.000
	CRR073319	Tawny withering 2	0.000
	CRR073320	Tawny withering 3	0.116