Gene detail

Detail information of GWHGAAZE024531

Functional Annotation

Database	Orthologs	E value	Annotation

Location And Transcript Sequence (JBrowse)

Scaffold	Type	Start	End	Strand
GWHAAZE00000007	gene	44343228	44344525	-
GWHAAZE00000007	mRNA	44343228	44344525	-
GWHAAZE00000007	exon	44344475	44344525	-
GWHAAZE00000007	exon	44344240	44344328	-
GWHAAZE00000007	exon	44343909	44343971	-
GWHAAZE00000007	exon	44343479	44343614	-
GWHAAZE00000007	exon	44343228	44343400	-
GWHAAZE00000007	CDS	44344475	44344525	-
GWHAAZE00000007	CDS	44344240	44344328	-
GWHAAZE00000007	CDS	44343909	44343971	-
GWHAAZE00000007	CDS	44343479	44343614	-
GWHAAZE00000007	CDS	44343272	44343400	-
GWHAAZE00000007	three_prime_UTR	44343228	44343271	-

Transcript Sequence
>GWHTAAZE024565 ATGGTGGATTTTGTTGAAGAAAAACTGATTGATTTGCGTAATTTACGTAAGGAGGAGGAATCAGACGATTTGTTAGAGCAATTAAGTAAATCCAAGAGTGATGTCCTTCGAGGAACGTATCCCAACGATATCACCCGTATATCCTTAGGATATGGAGAGATTCCGAAGGCACGCGACGATGGCAAGCAAAATTTGGTGAAACTGAAACTATTGAGGTGGAATTTGTTTGTGGTACTGGCCTTTGCTTTGCTTGTAGTGCGTGGATCTGGATCATTTGATGATAACCCCTCTCTCGGCCGACTCTGCTGTGCAGCTATTGACAAGTTCAATCGAGTAAATCTTCGGCAATACAAATTTGCTAGAGCACTTGAGGCTTATCGCTTTATCCTTGTCGCGGACAAATTGTACTATATCACTCTTGAGGCTACTACTGAAGCTGGTTATACTGAAATCTTCAAAGTCAAGTGAATTGCAATACTAAAGATGAAGTAGAAGTTGTGAATATTGAATGT

Network for GWHGAAZE024531

Network category	Network	Top300 PCC genelist
Coexpression Positive	Network	Top300 PCC genelist
Coexpression Negative	Network	Top300 PCC genelist

Functional Module

Module ID	Function Annotation
CFinderModule0136	GO:0033179 proton-transporting V-type ATPase, V0 domain GOslim:cellular_component GO:1902600 proton transmembrane transport GOslim:biological_process GO:0015078 proton transmembrane transporter activity GOslim:molecular_function GO:0000166 nucleotide binding GOslim:molecular_function map04142 Lysosome map04966 Collecting duct acid secretion map04721 Synaptic vesicle cycle map04145 Phagosome map00190 Oxidative phosphorylation

Module ID

Function Annotation

CFinderModule0136

GO:0033179 proton-transporting V-type ATPase, V0 domain GOslim:cellular_component
GO:1902600 proton transmembrane transport GOslim:biological_process
GO:0015078 proton transmembrane transporter activity GOslim:molecular_function
GO:0000166 nucleotide binding GOslim:molecular_function
map04142 Lysosome
map04966 Collecting duct acid secretion
map04721 Synaptic vesicle cycle
map04145 Phagosome
map00190 Oxidative phosphorylation

Protein Structure

Pfam accession	Pfam name	Alignment start	Alignment end	E-value
--	--	--	--	--

Protein Sequence

Gene family

Gene family	subfamily
--	--

KEGG pathway

KO	Enzyme	pathway	mapID
--	--	--	--

Gene Ontology

GO term	Ontology	Name

Expression pattern

Expression pattern detail

SRP	Sample	Description	TPM
SRP075780	SRR3591705	youngest leaf	1.189
	SRR3591706	second leaf	0.538
	SRR3591707	mature leaf	0.519
	SRR3591708	Shoot apex	0.656
	SRR3591709	Stem	1.303
	SRR3591710	White floral bud	0.375
	SRR3591711	White flower	0.124
	SRR3591712	Green floral bud	0.027
	SRR3591713	Yellow flower	0.244
SRP173429	SRR8316895	Juvenile bud stage	0.000
	SRR8316896	Juvenile bud stage	0.000
	SRR8316897	Juvenile bud stage	0.284
	SRR8316894	Third green stage	0.065
	SRR8316900	Third green stage	0.000
	SRR8316901	Third green stage	0.000
	SRR8316898	Complete white stage	0.000
	SRR8316899	Complete white stage	0.000
	SRR8316903	Complete white stage	0.000
	SRR8316902	Silver flowering stage	0.000
	SRR8316904	Silver flowering stage	0.083
	SRR8316905	Silver flowering stage	0.064
	SRR8316906	Gold flowering stage	0.000
	SRR8316907	Gold flowering stage	0.000
	SRR8316908	Gold flowering stage	0.431
SRP132670	SRR6706286	Control	0.071
	SRR6706287	Light intensity 50%	0.085
	SRR6706288	Light intensity 20%	0.029
CNP0000432	CNS0095592	Slightly white alabastrum(diploid) 1	0.000
	CNS0095593	Slightly white alabastrum(diploid) 2	0.000
	CNS0095594	Slightly white alabastrum(diploid) 3	0.044
	CNS0095595	Whole white alabastrum(diploid) 2	0.000
	CNS0095596	Whole white alabastrum(diploid) 3	0.000
	CNS0095597	Whole white alabastrum(diploid) 4	0.000
	CNS0095598	Silvery flower (diploied) 1	0.000
	CNS0095599	Silvery flower (diploied) 2	0.047
	CNS0095600	Silvery flower (diploied) 3	0.000
	CNS0095601	Golden flower (diploid) 1	0.000
	CNS0095602	Golden flower (diploid) 2	0.074
	CNS0095603	Golden flower (diploid) 3	0.000
	CNS0095604	Slightly white alabastrum(tetraploid) 1	0.140
	CNS0095605	Slightly white alabastrum(tetraploid) 2	0.386
	CNS0095606	Slightly white alabastrum(tetraploid) 3	0.913
	CNS0095607	Whole white alabastrum(tetraploid) 1	0.520
	CNS0095608	Whole white alabastrum(tetraploid) 2	0.366
	CNS0095609	Whole white alabastrum(tetraploid) 3	0.996
	CNS0095610	Silvery flower (diploied) 1	1.117
	CNS0095611	Silvery flower (diploied) 2	0.892
	CNS0095612	Silvery flower (diploied) 3	0.271
	CNS0095613	Golden flower (tetraploid) 1	0.629
	CNS0095614	Golden flower (tetraploid) 2	0.656
	CNS0095615	Golden flower (tetraploid) 3	0.590
CRA001975	CRR073297	Stem 1	0.184
	CRR073298	Stem 2	0.000
	CRR073299	Stem 3	0.081
	CRR073300	Leaf 1	0.000
	CRR073301	Leaf 2	0.000
	CRR073302	Leaf 3	0.000
	CRR073303	Juvenile bud 1	0.036
	CRR073304	Juvenile bud 2	0.147
	CRR073305	Juvenile bud 3	0.087
	CRR073306	Third green 1	0.000
	CRR073307	Third green 2	0.000
	CRR073308	Third green 3	0.000
	CRR073309	Second white 1	0.000
	CRR073310	Second white 2	0.000
	CRR073311	Second white 3	0.000
	CRR073312	Silver flowering 1	0.000
	CRR073313	Silver flowering 2	0.000
	CRR073314	Silver flowering 3	0.000
	CRR073315	Gold flowering 1	0.000
	CRR073316	Gold flowering 2	0.206
	CRR073317	Gold flowering 3	0.000
	CRR073318	Tawny withering 1	0.186
	CRR073319	Tawny withering 2	0.000
	CRR073320	Tawny withering 3	0.000