Gene detail

Detail information of GWHGAAZE024803

Functional Annotation

Database	Orthologs	E value	Annotation
Nr	XP_010267478.1	1.05204E-39	PREDICTED: ATP synthase delta chain, chloroplastic [Nelumbo nucifera]
trEMBL	tr\|M5XHV8\|M5XHV8_PRUPE	1E-36	Uncharacterized protein {ECO:0000313\|EMBL:EMJ21058.1} (Fragment)
TAIR10	AT4G00895.1	0.000002	ATPase, F1 complex, OSCP/delta subunit protein

Location And Transcript Sequence (JBrowse)

Scaffold	Type	Start	End	Strand
GWHAAZE00000007	gene	49693876	49694457	+
GWHAAZE00000007	mRNA	49693876	49694457	+
GWHAAZE00000007	exon	49693876	49694457	+
GWHAAZE00000007	CDS	49693876	49694457	+

Transcript Sequence
>GWHTAAZE024837 ATGGATACTCTGTCCGCCTCCGTTACCTCTTTGAACATTCCTCCCATACAATCATGTACAACAACAACTTCCCGTGAACTCTACCATTTCAAATTCCACAATCCATTGCATAATTTCCCTCCAAACCCCCAACTCTCTTCCTTCAAGAAACCCACTTCCAAAATCTCCAACAACAGACCCACAACCTTGACCCACAAGAATTCCATCCCTTCTCCGTTCATACCCGCTTCTCAGACTCAAACTCTCAAACACCCACCAACTGTTCACCGAAATGCTGCAACGGGATACGCGGCTGCACTAATAGATGCAGCCAGTTGCAAAAACATGCTGGGTTCGGTGGAGAGAGACGTGAAGAGGCTGTTGAAGTTGATGAGGAACAAGCAGCTGAGAGCTTTCTTTAAAGAGGACGAGGTACTGGTAAAGGAGGTGTTGGAGAAGGGAGGATTTGTGAGGCATTTGGTGGTGCTGGTGAGGATGTTGGTGAAGAGGAATAAATTGGGAATGTTGAAGGGAGTGTTGGATGAATTTCACAGGATTTATGAGGAGTTGTCGAGTGGACATTATTTGGTTTATGATTGTTAG

Network for GWHGAAZE024803

Network category	Network	Top300 PCC genelist
Coexpression Positive	Network	Top300 PCC genelist
Coexpression Negative	Network	Top300 PCC genelist

Functional Module

Module ID	Function Annotation

Protein Structure

Pfam accession	Pfam name	Alignment start	Alignment end	E-value
PF00213.19	OSCP	93	182	1.40E-08

Protein Sequence

Gene family

Gene family	subfamily
--	--

KEGG pathway

KO	Enzyme	pathway	mapID
K02113	ATPF1D, atpH	Metabolic pathways	map01100
		Oxidative phosphorylation	map00190
		Photosynthesis	map00195

Gene Ontology

GO term	Ontology	Name
GO:0015986	biological_process	ATP synthesis coupled proton transport
GO:0046933	molecular_function	proton-transporting ATP synthase activity, rotational mechanism

Expression pattern

Expression pattern detail

SRP	Sample	Description	TPM
SRP075780	SRR3591705	youngest leaf	14.551
	SRR3591706	second leaf	114.353
	SRR3591707	mature leaf	119.806
	SRR3591708	Shoot apex	78.024
	SRR3591709	Stem	9.084
	SRR3591710	White floral bud	22.932
	SRR3591711	White flower	28.586
	SRR3591712	Green floral bud	74.351
	SRR3591713	Yellow flower	35.682
SRP173429	SRR8316895	Juvenile bud stage	30.932
	SRR8316896	Juvenile bud stage	37.932
	SRR8316897	Juvenile bud stage	14.779
	SRR8316894	Third green stage	21.373
	SRR8316900	Third green stage	103.368
	SRR8316901	Third green stage	70.230
	SRR8316898	Complete white stage	12.424
	SRR8316899	Complete white stage	40.476
	SRR8316903	Complete white stage	17.369
	SRR8316902	Silver flowering stage	18.747
	SRR8316904	Silver flowering stage	24.987
	SRR8316905	Silver flowering stage	22.885
	SRR8316906	Gold flowering stage	35.966
	SRR8316907	Gold flowering stage	45.522
	SRR8316908	Gold flowering stage	23.454
SRP132670	SRR6706286	Control	125.571
	SRR6706287	Light intensity 50%	139.225
	SRR6706288	Light intensity 20%	153.328
CNP0000432	CNS0095592	Slightly white alabastrum(diploid) 1	33.361
	CNS0095593	Slightly white alabastrum(diploid) 2	30.218
	CNS0095594	Slightly white alabastrum(diploid) 3	30.817
	CNS0095595	Whole white alabastrum(diploid) 2	38.748
	CNS0095596	Whole white alabastrum(diploid) 3	47.131
	CNS0095597	Whole white alabastrum(diploid) 4	33.868
	CNS0095598	Silvery flower (diploied) 1	45.519
	CNS0095599	Silvery flower (diploied) 2	39.874
	CNS0095600	Silvery flower (diploied) 3	60.936
	CNS0095601	Golden flower (diploid) 1	42.666
	CNS0095602	Golden flower (diploid) 2	68.495
	CNS0095603	Golden flower (diploid) 3	61.697
	CNS0095604	Slightly white alabastrum(tetraploid) 1	32.386
	CNS0095605	Slightly white alabastrum(tetraploid) 2	30.672
	CNS0095606	Slightly white alabastrum(tetraploid) 3	38.046
	CNS0095607	Whole white alabastrum(tetraploid) 1	14.273
	CNS0095608	Whole white alabastrum(tetraploid) 2	18.699
	CNS0095609	Whole white alabastrum(tetraploid) 3	63.746
	CNS0095610	Silvery flower (diploied) 1	24.537
	CNS0095611	Silvery flower (diploied) 2	32.550
	CNS0095612	Silvery flower (diploied) 3	35.057
	CNS0095613	Golden flower (tetraploid) 1	83.860
	CNS0095614	Golden flower (tetraploid) 2	40.616
	CNS0095615	Golden flower (tetraploid) 3	37.898
CRA001975	CRR073297	Stem 1	60.559
	CRR073298	Stem 2	68.249
	CRR073299	Stem 3	81.689
	CRR073300	Leaf 1	64.133
	CRR073301	Leaf 2	65.868
	CRR073302	Leaf 3	95.584
	CRR073303	Juvenile bud 1	68.305
	CRR073304	Juvenile bud 2	91.778
	CRR073305	Juvenile bud 3	59.504
	CRR073306	Third green 1	43.111
	CRR073307	Third green 2	38.468
	CRR073308	Third green 3	44.791
	CRR073309	Second white 1	85.621
	CRR073310	Second white 2	39.300
	CRR073311	Second white 3	48.142
	CRR073312	Silver flowering 1	60.066
	CRR073313	Silver flowering 2	74.428
	CRR073314	Silver flowering 3	43.464
	CRR073315	Gold flowering 1	222.152
	CRR073316	Gold flowering 2	205.736
	CRR073317	Gold flowering 3	274.887
	CRR073318	Tawny withering 1	13.670
	CRR073319	Tawny withering 2	14.408
	CRR073320	Tawny withering 3	15.418