Gene detail

Detail information of GWHGAAZE024934

Functional Annotation

Database	Orthologs	E value	Annotation
Nr	XP_011091479.1	1.7949E-99	PREDICTED: RING-H2 finger protein ATL39-like [Sesamum indicum]
Swissprot	tr\|Q9SL78\|ATL12_ARATH	3E-21	Putative RING-H2 finger protein ATL12 (Precursor)
trEMBL	tr\|A5BB61\|A5BB61_VITVI	1E-92	Putative uncharacterized protein {ECO:0000313\|EMBL:CAN65442.1}
TAIR10	AT2G20030.1	6E-19	RING/U-box superfamily protein

Location And Transcript Sequence (JBrowse)

Scaffold	Type	Start	End	Strand
GWHAAZE00000007	gene	51957467	51959631	+
GWHAAZE00000007	mRNA	51957467	51959631	+
GWHAAZE00000007	exon	51957467	51957625	+
GWHAAZE00000007	exon	51958363	51958460	+
GWHAAZE00000007	exon	51959286	51959631	+
GWHAAZE00000007	CDS	51957467	51957625	+
GWHAAZE00000007	CDS	51958363	51958460	+
GWHAAZE00000007	CDS	51959286	51959631	+

Transcript Sequence
>GWHTAAZE024968 ATGTTTGGGCCAGGCATGAATTTGATTACGACAGTCATTGGTTTTGCTATGAGTGCCACTTTTATTGTATTTATCTGCGCCAGACTTATTTGTGGGAGGCTCCGGCGGATTGAATCACGTCAATTGTTTGAAATTGATTCGAGGATTGATCTTGAGCAGCCAGAGCATCGAATTACGGGCCTTGAACCTGTCGTGGTTGCTGCAATCCCCACAATGAAGTTTGACCGTGAAGCTTTCAGTTCTATGGAAGATGCGCAGTGCACAATATGTTTAGGAGAGTACCAAGAGAAAGAAGTACTGAGAATAATGCCTAAATGTGGCCACAGTTTCCACCTCTCATGCATTGACGTATGGCTAAGAAAACAGTCGACCTGCCCGGTCTGTCGCCTCTCAGTACACAGCTCATCTGATAATAAACACACACTTGCCGTGGCTCGATCTTTCAACAACCCTGAGGCCCTCCCCAGTAATTCTCAACAGTGGCTGCTGCCTGCTGCCCATCGTTCGGAGGGCAATTTTGGAATTTACCAAGGGCGGGCTGAATCTGGTTCTGGATTCAGCCTTGAACCGGTTCGTTCAGAATTAGCGCAAGCAAGATTGTGA

Network for GWHGAAZE024934

Network category	Network	Top300 PCC genelist
Coexpression Positive	Network	Top300 PCC genelist
Coexpression Negative	Network	Top300 PCC genelist

Functional Module

Module ID	Function Annotation

Protein Structure

Pfam accession	Pfam name	Alignment start	Alignment end	E-value
PF13639.7	zf-RING_2	86	129	1.60E-14

Protein Sequence

Gene family

Gene family	subfamily
Ubiquitin Family	RING
Ubiquitin Family	U-box

KEGG pathway

KO	Enzyme	pathway	mapID
--	--	--	--

Gene Ontology

GO term	Ontology	Name

Expression pattern

Expression pattern detail

SRP	Sample	Description	TPM
SRP075780	SRR3591705	youngest leaf	13.701
	SRR3591706	second leaf	18.149
	SRR3591707	mature leaf	43.257
	SRR3591708	Shoot apex	18.674
	SRR3591709	Stem	23.552
	SRR3591710	White floral bud	8.126
	SRR3591711	White flower	10.747
	SRR3591712	Green floral bud	9.999
	SRR3591713	Yellow flower	8.957
SRP173429	SRR8316895	Juvenile bud stage	7.032
	SRR8316896	Juvenile bud stage	10.149
	SRR8316897	Juvenile bud stage	1.516
	SRR8316894	Third green stage	3.706
	SRR8316900	Third green stage	12.354
	SRR8316901	Third green stage	11.788
	SRR8316898	Complete white stage	3.759
	SRR8316899	Complete white stage	19.580
	SRR8316903	Complete white stage	5.535
	SRR8316902	Silver flowering stage	6.634
	SRR8316904	Silver flowering stage	5.945
	SRR8316905	Silver flowering stage	2.444
	SRR8316906	Gold flowering stage	11.734
	SRR8316907	Gold flowering stage	10.230
	SRR8316908	Gold flowering stage	14.596
SRP132670	SRR6706286	Control	11.035
	SRR6706287	Light intensity 50%	10.322
	SRR6706288	Light intensity 20%	10.256
CNP0000432	CNS0095592	Slightly white alabastrum(diploid) 1	7.376
	CNS0095593	Slightly white alabastrum(diploid) 2	8.285
	CNS0095594	Slightly white alabastrum(diploid) 3	8.407
	CNS0095595	Whole white alabastrum(diploid) 2	5.231
	CNS0095596	Whole white alabastrum(diploid) 3	6.818
	CNS0095597	Whole white alabastrum(diploid) 4	5.835
	CNS0095598	Silvery flower (diploied) 1	11.754
	CNS0095599	Silvery flower (diploied) 2	11.981
	CNS0095600	Silvery flower (diploied) 3	13.988
	CNS0095601	Golden flower (diploid) 1	12.983
	CNS0095602	Golden flower (diploid) 2	15.675
	CNS0095603	Golden flower (diploid) 3	11.761
	CNS0095604	Slightly white alabastrum(tetraploid) 1	6.903
	CNS0095605	Slightly white alabastrum(tetraploid) 2	5.908
	CNS0095606	Slightly white alabastrum(tetraploid) 3	12.300
	CNS0095607	Whole white alabastrum(tetraploid) 1	4.254
	CNS0095608	Whole white alabastrum(tetraploid) 2	4.622
	CNS0095609	Whole white alabastrum(tetraploid) 3	7.440
	CNS0095610	Silvery flower (diploied) 1	10.771
	CNS0095611	Silvery flower (diploied) 2	11.971
	CNS0095612	Silvery flower (diploied) 3	15.391
	CNS0095613	Golden flower (tetraploid) 1	5.955
	CNS0095614	Golden flower (tetraploid) 2	8.773
	CNS0095615	Golden flower (tetraploid) 3	12.647
CRA001975	CRR073297	Stem 1	24.147
	CRR073298	Stem 2	28.086
	CRR073299	Stem 3	24.554
	CRR073300	Leaf 1	18.526
	CRR073301	Leaf 2	19.679
	CRR073302	Leaf 3	18.029
	CRR073303	Juvenile bud 1	17.687
	CRR073304	Juvenile bud 2	11.734
	CRR073305	Juvenile bud 3	12.331
	CRR073306	Third green 1	15.129
	CRR073307	Third green 2	7.531
	CRR073308	Third green 3	12.286
	CRR073309	Second white 1	18.617
	CRR073310	Second white 2	21.187
	CRR073311	Second white 3	9.473
	CRR073312	Silver flowering 1	4.821
	CRR073313	Silver flowering 2	6.954
	CRR073314	Silver flowering 3	3.082
	CRR073315	Gold flowering 1	64.512
	CRR073316	Gold flowering 2	68.201
	CRR073317	Gold flowering 3	55.838
	CRR073318	Tawny withering 1	30.466
	CRR073319	Tawny withering 2	21.919
	CRR073320	Tawny withering 3	29.812