Gene detail

Detail information of GWHGAAZE025152

Functional Annotation

Database	Orthologs	E value	Annotation
Nr	CDP07637.1	2.997E-124	unnamed protein product [Coffea canephora]
COG	NP_102415.1	3E-21	30S ribosomal protein S2
Swissprot	tr\|Q9GCB9\|RT02_ARATH	2E-89	Ribosomal protein S2, mitochondrial
trEMBL	tr\|A0A068UHA8\|A0A068UHA8_COFCA	1E-124	Coffea canephora DH200=94 genomic scaffold, scaffold_27 {ECO:0000313\|EMBL:CDP07637.1}
TAIR10	AT3G03600.1	8E-72	ribosomal protein S2

Location And Transcript Sequence (JBrowse)

Scaffold	Type	Start	End	Strand
GWHAAZE00000007	gene	56113778	56114458	-
GWHAAZE00000007	mRNA	56113778	56114458	-
GWHAAZE00000007	exon	56113778	56114458	-
GWHAAZE00000007	CDS	56113778	56114458	-

Transcript Sequence
>GWHTAAZE025186 ATGACAATCCACTCGGTAGTGATTCAAAAGCTACTGAGCACCAACGCCCATTTAGGCCGCCGTGTCGCCGCTCACCACTTCAAAATCTACACCTACGGTGCTCGAAATGCCATGACCATAATCGACTCCGACAAAACCCTAATTTGCATCCGAAACGCCTGCAATTTCATCGGGAACCTCGTCCGCCAGAACGGCCGGTTTCTCTTCGTCAACACCAACACCCTCTGCGACGAAATCATCGATCAAATGACGAATAAAATCGGCGTCAAGAAAGACAATTCATGGAAATTAGGAGGCTTTTTGACCAACAGTTCAAGCCCTAAGAAATTCCGGTCGAGGAACAAGAAGTTGAATCTCGGAGCAATTCATCCTCCTGATTGTGTGGTGATAATGGACACGGAGAGGAAATCTTCGGTTATACTCGAGGCCGATCGCTTGCAGATTCCGATTGTGGGTTTGGTGGATCCGAGTATGCCTTGGGATACGTATAAGAAGATTACTTACCCTGTTCCTGCTAATGATACAGTGCAGTTTGTTTATTTGTTTTGTAATTTGATTACAAAGACTTTCCTTTATGAGCAAAAAAGGTCTGGTGCTGCAATTGAGAATTTGAAGAGACAGGAGGAAGTAGCTGCTCCACAACTGACCTCCCCAGAAAGTGAAACTAGGTATGATGTTCAG

Network for GWHGAAZE025152

Network category	Network	Top300 PCC genelist
Coexpression Positive	Network	Top300 PCC genelist
Coexpression Negative	Network	Top300 PCC genelist

Functional Module

Module ID	Function Annotation

Protein Structure

Pfam accession	Pfam name	Alignment start	Alignment end	E-value
PF00318.21	Ribosomal_S2	11	113	1.20E-16
PF00318.21	Ribosomal_S2	123	189	2.10E-11

Protein Sequence

Gene family

Gene family	subfamily
--	--

KEGG pathway

KO	Enzyme	pathway	mapID
K00963	UGP2, galU, galF	Metabolic pathways	map01100
		Biosynthesis of secondary metabolites	map01110
		Pentose and glucuronate interconversions	map00040
		Galactose metabolism	map00052
		Starch and sucrose metabolism	map00500
		Amino sugar and nucleotide sugar metabolism	map00520

Gene Ontology

GO term	Ontology	Name
GO:0006412	biological_process	translation
GO:0005840	cellular_component	ribosome
GO:0003735	molecular_function	structural constituent of ribosome

Expression pattern

Expression pattern detail

SRP	Sample	Description	TPM
SRP075780	SRR3591705	youngest leaf	44.422
	SRR3591706	second leaf	24.720
	SRR3591707	mature leaf	16.519
	SRR3591708	Shoot apex	38.143
	SRR3591709	Stem	25.060
	SRR3591710	White floral bud	28.658
	SRR3591711	White flower	33.588
	SRR3591712	Green floral bud	45.501
	SRR3591713	Yellow flower	26.982
SRP173429	SRR8316895	Juvenile bud stage	36.557
	SRR8316896	Juvenile bud stage	56.037
	SRR8316897	Juvenile bud stage	28.613
	SRR8316894	Third green stage	29.036
	SRR8316900	Third green stage	82.902
	SRR8316901	Third green stage	74.960
	SRR8316898	Complete white stage	27.288
	SRR8316899	Complete white stage	83.301
	SRR8316903	Complete white stage	33.828
	SRR8316902	Silver flowering stage	24.208
	SRR8316904	Silver flowering stage	30.004
	SRR8316905	Silver flowering stage	12.117
	SRR8316906	Gold flowering stage	44.244
	SRR8316907	Gold flowering stage	43.783
	SRR8316908	Gold flowering stage	53.279
SRP132670	SRR6706286	Control	76.618
	SRR6706287	Light intensity 50%	77.336
	SRR6706288	Light intensity 20%	78.130
CNP0000432	CNS0095592	Slightly white alabastrum(diploid) 1	38.011
	CNS0095593	Slightly white alabastrum(diploid) 2	43.012
	CNS0095594	Slightly white alabastrum(diploid) 3	41.433
	CNS0095595	Whole white alabastrum(diploid) 2	36.058
	CNS0095596	Whole white alabastrum(diploid) 3	48.411
	CNS0095597	Whole white alabastrum(diploid) 4	33.153
	CNS0095598	Silvery flower (diploied) 1	24.928
	CNS0095599	Silvery flower (diploied) 2	23.937
	CNS0095600	Silvery flower (diploied) 3	40.644
	CNS0095601	Golden flower (diploid) 1	22.118
	CNS0095602	Golden flower (diploid) 2	36.609
	CNS0095603	Golden flower (diploid) 3	35.707
	CNS0095604	Slightly white alabastrum(tetraploid) 1	40.822
	CNS0095605	Slightly white alabastrum(tetraploid) 2	41.441
	CNS0095606	Slightly white alabastrum(tetraploid) 3	52.235
	CNS0095607	Whole white alabastrum(tetraploid) 1	31.251
	CNS0095608	Whole white alabastrum(tetraploid) 2	26.600
	CNS0095609	Whole white alabastrum(tetraploid) 3	55.628
	CNS0095610	Silvery flower (diploied) 1	37.578
	CNS0095611	Silvery flower (diploied) 2	38.052
	CNS0095612	Silvery flower (diploied) 3	32.764
	CNS0095613	Golden flower (tetraploid) 1	20.665
	CNS0095614	Golden flower (tetraploid) 2	31.907
	CNS0095615	Golden flower (tetraploid) 3	26.701
CRA001975	CRR073297	Stem 1	67.747
	CRR073298	Stem 2	62.030
	CRR073299	Stem 3	68.671
	CRR073300	Leaf 1	82.590
	CRR073301	Leaf 2	76.811
	CRR073302	Leaf 3	88.602
	CRR073303	Juvenile bud 1	89.631
	CRR073304	Juvenile bud 2	73.380
	CRR073305	Juvenile bud 3	69.347
	CRR073306	Third green 1	22.899
	CRR073307	Third green 2	23.932
	CRR073308	Third green 3	29.694
	CRR073309	Second white 1	23.789
	CRR073310	Second white 2	30.707
	CRR073311	Second white 3	16.914
	CRR073312	Silver flowering 1	13.832
	CRR073313	Silver flowering 2	13.117
	CRR073314	Silver flowering 3	15.257
	CRR073315	Gold flowering 1	43.653
	CRR073316	Gold flowering 2	48.333
	CRR073317	Gold flowering 3	27.198
	CRR073318	Tawny withering 1	51.286
	CRR073319	Tawny withering 2	39.810
	CRR073320	Tawny withering 3	49.145