Gene detail

Detail information of GWHGAAZE025413

Functional Annotation

Database	Orthologs	E value	Annotation
Nr	XP_011003942.1	3.58402E-90	PREDICTED: ribulose-phosphate 3-epimerase, cytoplasmic isoform [Populus euphratica]
COG	YP_004321712.1	2E-41	ribulose-phosphate 3-epimerase
Swissprot	tr\|Q9SE42\|RPE1_ORYSJ	5E-87	Ribulose-phosphate 3-epimerase, cytoplasmic isoform
trEMBL	tr\|A9PIC8\|A9PIC8_POPTR	6E-90	Ribulose-phosphate 3-epimerase {ECO:0000256\|PIRNR:PIRNR001461}
TAIR10	AT3G01850.2	4E-68	Aldolase-type TIM barrel family protein

Location And Transcript Sequence (JBrowse)

Scaffold	Type	Start	End	Strand
GWHAAZE00000007	gene	60878472	60881961	+
GWHAAZE00000007	mRNA	60878472	60881961	+
GWHAAZE00000007	exon	60878472	60878590	+
GWHAAZE00000007	exon	60880647	60880730	+
GWHAAZE00000007	exon	60880823	60880936	+
GWHAAZE00000007	exon	60881048	60881114	+
GWHAAZE00000007	exon	60881381	60881473	+
GWHAAZE00000007	exon	60881854	60881961	+
GWHAAZE00000007	CDS	60878472	60878590	+
GWHAAZE00000007	CDS	60880647	60880730	+
GWHAAZE00000007	CDS	60880823	60880936	+
GWHAAZE00000007	CDS	60881048	60881114	+
GWHAAZE00000007	CDS	60881381	60881473	+
GWHAAZE00000007	CDS	60881854	60881961	+

Transcript Sequence
>GWHTAAZE025447 AAGATAACTCCGTCTATGCTGTCAGCGGACTTCGCCAATTTAGCTTGCGAGGCCGATCGTATGCTCCGGTGCGGCGCCAATTGGCTCCACATGGATATCATGGTAATCATCACACTTCAATCCATTTCTGTTTACTGCAGGCATTTTGTTCCAAATCTTACTATTGGTTCTCTGGTCATTGACAGTCTGCAAAAGCACACAAAGGTGTACTTGGATTGCCGCCTTATGGTCACAAATCCTCTTGATTATGTCGAACAATTAGGAAAAGCTGGTGCTTCAGGTTTTACATTTCACGTTGAGGCATCTAAAGGTGAACTGTCAAAGGGCATGAGGCCTGGTGTGGCGTTAAAACCCGGAACACCCATTGAAGAAGTGTATCCACTGCTTGATGGTGAAAATCCTGTGGAAATGGTTCTTTTAATGACTCTGGAACCTGGATTTGGTGGACAAAAGTTCTTGCCAGAAATGATGGATAAGGTACAAGTGCTGAGAAAGAAGTACCCGTCACTTGATATAGAGATCGGTTCATGTCTTACAGTACTACTTCAATTTCGTTTGCATTTGTCCATGTTCTTGTTTGCCTAG

Network for GWHGAAZE025413

Network category	Network	Top300 PCC genelist
Coexpression Positive	Network	Top300 PCC genelist
Coexpression Negative	Network	Top300 PCC genelist

Functional Module

Module ID	Function Annotation

Protein Structure

Pfam accession	Pfam name	Alignment start	Alignment end	E-value
PF00834.20	Ribul_P_3_epim	1	172	7.90E-42

Protein Sequence

Gene family

Gene family	subfamily
--	--

KEGG pathway

KO	Enzyme	pathway	mapID
K01783	rpe, RPE	Metabolic pathways	map01100
		Biosynthesis of secondary metabolites	map01110
		Microbial metabolism in diverse environments	map01120
		Carbon metabolism	map01200
		Biosynthesis of amino acids	map01230
		Pentose phosphate pathway	map00030
		Pentose and glucuronate interconversions	map00040
		Carbon fixation in photosynthetic organisms	map00710

Gene Ontology

GO term	Ontology	Name
GO:0005975	biological_process	carbohydrate metabolic process
GO:0016857	molecular_function	racemase and epimerase activity, acting on carbohydrates and derivatives
GO:0003824	molecular_function	catalytic activity

Expression pattern

Expression pattern detail

SRP	Sample	Description	TPM
SRP075780	SRR3591705	youngest leaf	0.000
	SRR3591706	second leaf	0.000
	SRR3591707	mature leaf	0.000
	SRR3591708	Shoot apex	0.000
	SRR3591709	Stem	0.000
	SRR3591710	White floral bud	0.000
	SRR3591711	White flower	0.000
	SRR3591712	Green floral bud	0.000
	SRR3591713	Yellow flower	0.000
SRP173429	SRR8316895	Juvenile bud stage	0.212
	SRR8316896	Juvenile bud stage	0.473
	SRR8316897	Juvenile bud stage	0.073
	SRR8316894	Third green stage	0.237
	SRR8316900	Third green stage	0.405
	SRR8316901	Third green stage	0.536
	SRR8316898	Complete white stage	0.016
	SRR8316899	Complete white stage	1.074
	SRR8316903	Complete white stage	0.140
	SRR8316902	Silver flowering stage	0.000
	SRR8316904	Silver flowering stage	0.000
	SRR8316905	Silver flowering stage	0.000
	SRR8316906	Gold flowering stage	0.000
	SRR8316907	Gold flowering stage	0.000
	SRR8316908	Gold flowering stage	0.086
SRP132670	SRR6706286	Control	0.911
	SRR6706287	Light intensity 50%	0.768
	SRR6706288	Light intensity 20%	0.527
CNP0000432	CNS0095592	Slightly white alabastrum(diploid) 1	1.358
	CNS0095593	Slightly white alabastrum(diploid) 2	1.229
	CNS0095594	Slightly white alabastrum(diploid) 3	1.278
	CNS0095595	Whole white alabastrum(diploid) 2	0.473
	CNS0095596	Whole white alabastrum(diploid) 3	0.641
	CNS0095597	Whole white alabastrum(diploid) 4	1.058
	CNS0095598	Silvery flower (diploied) 1	1.207
	CNS0095599	Silvery flower (diploied) 2	0.822
	CNS0095600	Silvery flower (diploied) 3	0.107
	CNS0095601	Golden flower (diploid) 1	0.320
	CNS0095602	Golden flower (diploid) 2	0.000
	CNS0095603	Golden flower (diploid) 3	0.000
	CNS0095604	Slightly white alabastrum(tetraploid) 1	0.930
	CNS0095605	Slightly white alabastrum(tetraploid) 2	0.116
	CNS0095606	Slightly white alabastrum(tetraploid) 3	0.037
	CNS0095607	Whole white alabastrum(tetraploid) 1	0.043
	CNS0095608	Whole white alabastrum(tetraploid) 2	0.000
	CNS0095609	Whole white alabastrum(tetraploid) 3	0.565
	CNS0095610	Silvery flower (diploied) 1	0.000
	CNS0095611	Silvery flower (diploied) 2	0.019
	CNS0095612	Silvery flower (diploied) 3	0.000
	CNS0095613	Golden flower (tetraploid) 1	0.000
	CNS0095614	Golden flower (tetraploid) 2	0.000
	CNS0095615	Golden flower (tetraploid) 3	0.000
CRA001975	CRR073297	Stem 1	0.416
	CRR073298	Stem 2	0.108
	CRR073299	Stem 3	0.000
	CRR073300	Leaf 1	0.683
	CRR073301	Leaf 2	0.390
	CRR073302	Leaf 3	0.000
	CRR073303	Juvenile bud 1	0.000
	CRR073304	Juvenile bud 2	0.163
	CRR073305	Juvenile bud 3	0.000
	CRR073306	Third green 1	0.000
	CRR073307	Third green 2	0.000
	CRR073308	Third green 3	0.000
	CRR073309	Second white 1	0.000
	CRR073310	Second white 2	0.000
	CRR073311	Second white 3	0.000
	CRR073312	Silver flowering 1	0.000
	CRR073313	Silver flowering 2	0.000
	CRR073314	Silver flowering 3	0.000
	CRR073315	Gold flowering 1	0.000
	CRR073316	Gold flowering 2	0.000
	CRR073317	Gold flowering 3	0.000
	CRR073318	Tawny withering 1	0.000
	CRR073319	Tawny withering 2	0.000
	CRR073320	Tawny withering 3	0.000