Gene detail

Detail information of GWHGAAZE025695

Functional Annotation

Database	Orthologs	E value	Annotation
Nr	XP_010249578.1	4.74641E-61	PREDICTED: dehydration-responsive element-binding protein 3-like [Nelumbo nucifera]
Swissprot	tr\|Q9LYD3\|DREB3_ARATH	4E-53	Dehydration-responsive element-binding protein 3
trEMBL	tr\|M5W330\|M5W330_PRUPE	9E-60	Uncharacterized protein {ECO:0000313\|EMBL:EMJ03663.1}
TAIR10	AT5G11590.1	2E-34	Integrase-type DNA-binding superfamily protein

Location And Transcript Sequence (JBrowse)

Scaffold	Type	Start	End	Strand
GWHAAZE00000007	gene	66145432	66146004	+
GWHAAZE00000007	mRNA	66145432	66146004	+
GWHAAZE00000007	exon	66145432	66145758	+
GWHAAZE00000007	exon	66145792	66146004	+
GWHAAZE00000007	CDS	66145432	66145758	+
GWHAAZE00000007	CDS	66145792	66146004	+

Transcript Sequence
>GWHTAAZE025729 ATGCGCACATGGGGCAAATGGGTATCCGAGATCCGAGAACCCAAGAAGAAGTCCCGGATCTGGCTAGGCACTTTCTCAACACCCGAAATGGCCGCCCGTGCCCACGACGTCGCCGCTATGTCCATAAAAGGAAACACGGCCATCCTCAACTTCCCCGAAATCTCCGACCTCCTCCCCCGCCCCGCTACGAGCTCTGCACGTGACGTCCAGGCCGCAGCCGCTATCGCCGCCTCCATGGACCACCTCGACCGGCGCGTGGATTGCACGCGATCGGACGAAGGGTCGACGGACCACATATGTCGGGGCGTGAAATACCCGCGCACGGAGGAGTTGGGGGAGATAGTTGAGTTACCGAGTTTGGGTGCGAGTTACGAATCGGCCGAGTCGAGTGGCGATTTTGTGTTTGTTGACTCGGTGGTTGATGGGTGGTGCTATCCTCCCCCGTGGTTGCACAGTGCGGAAGATCACTGTGGGTATTTTGCTGAGCCAGATCAGAGTATTTTTTCCACCAGTTTCGAGGCATTATTGTGGCAGCATTAA

Network for GWHGAAZE025695

Network category	Network	Top300 PCC genelist
Coexpression Positive	Network	Top300 PCC genelist
Coexpression Negative	Network	Top300 PCC genelist

Functional Module

Module ID	Function Annotation

Protein Structure

Pfam accession	Pfam name	Alignment start	Alignment end	E-value
PF00847.21	AP2	3	44	9.00E-10

Protein Sequence

Gene family

Gene family	subfamily
Transcription Factors Family	AP2/ERF-ERF

KEGG pathway

KO	Enzyme	pathway	mapID
--	--	--	--

Gene Ontology

GO term	Ontology	Name
GO:0006355	biological_process	regulation of transcription, DNA-templated
GO:0003700	molecular_function	DNA-binding transcription factor activity
GO:0003677	molecular_function	DNA binding

Expression pattern

Expression pattern detail

SRP	Sample	Description	TPM
SRP075780	SRR3591705	youngest leaf	7.599
	SRR3591706	second leaf	2.894
	SRR3591707	mature leaf	12.525
	SRR3591708	Shoot apex	1.961
	SRR3591709	Stem	3.055
	SRR3591710	White floral bud	2.036
	SRR3591711	White flower	1.478
	SRR3591712	Green floral bud	3.724
	SRR3591713	Yellow flower	0.591
SRP173429	SRR8316895	Juvenile bud stage	39.039
	SRR8316896	Juvenile bud stage	47.413
	SRR8316897	Juvenile bud stage	22.405
	SRR8316894	Third green stage	6.054
	SRR8316900	Third green stage	10.204
	SRR8316901	Third green stage	36.419
	SRR8316898	Complete white stage	0.075
	SRR8316899	Complete white stage	12.932
	SRR8316903	Complete white stage	0.666
	SRR8316902	Silver flowering stage	0.166
	SRR8316904	Silver flowering stage	0.738
	SRR8316905	Silver flowering stage	0.095
	SRR8316906	Gold flowering stage	0.202
	SRR8316907	Gold flowering stage	0.000
	SRR8316908	Gold flowering stage	0.320
SRP132670	SRR6706286	Control	5.853
	SRR6706287	Light intensity 50%	7.113
	SRR6706288	Light intensity 20%	7.394
CNP0000432	CNS0095592	Slightly white alabastrum(diploid) 1	27.360
	CNS0095593	Slightly white alabastrum(diploid) 2	36.575
	CNS0095594	Slightly white alabastrum(diploid) 3	37.758
	CNS0095595	Whole white alabastrum(diploid) 2	34.665
	CNS0095596	Whole white alabastrum(diploid) 3	3.132
	CNS0095597	Whole white alabastrum(diploid) 4	22.891
	CNS0095598	Silvery flower (diploied) 1	35.887
	CNS0095599	Silvery flower (diploied) 2	116.405
	CNS0095600	Silvery flower (diploied) 3	25.446
	CNS0095601	Golden flower (diploid) 1	25.860
	CNS0095602	Golden flower (diploid) 2	24.875
	CNS0095603	Golden flower (diploid) 3	27.975
	CNS0095604	Slightly white alabastrum(tetraploid) 1	8.499
	CNS0095605	Slightly white alabastrum(tetraploid) 2	10.746
	CNS0095606	Slightly white alabastrum(tetraploid) 3	18.244
	CNS0095607	Whole white alabastrum(tetraploid) 1	4.489
	CNS0095608	Whole white alabastrum(tetraploid) 2	2.535
	CNS0095609	Whole white alabastrum(tetraploid) 3	4.446
	CNS0095610	Silvery flower (diploied) 1	0.443
	CNS0095611	Silvery flower (diploied) 2	0.597
	CNS0095612	Silvery flower (diploied) 3	1.016
	CNS0095613	Golden flower (tetraploid) 1	0.023
	CNS0095614	Golden flower (tetraploid) 2	0.191
	CNS0095615	Golden flower (tetraploid) 3	0.000
CRA001975	CRR073297	Stem 1	21.835
	CRR073298	Stem 2	33.978
	CRR073299	Stem 3	29.075
	CRR073300	Leaf 1	39.393
	CRR073301	Leaf 2	47.098
	CRR073302	Leaf 3	24.939
	CRR073303	Juvenile bud 1	17.936
	CRR073304	Juvenile bud 2	5.016
	CRR073305	Juvenile bud 3	50.543
	CRR073306	Third green 1	0.404
	CRR073307	Third green 2	1.921
	CRR073308	Third green 3	2.323
	CRR073309	Second white 1	0.057
	CRR073310	Second white 2	0.000
	CRR073311	Second white 3	0.170
	CRR073312	Silver flowering 1	0.000
	CRR073313	Silver flowering 2	1.091
	CRR073314	Silver flowering 3	0.000
	CRR073315	Gold flowering 1	20.418
	CRR073316	Gold flowering 2	32.331
	CRR073317	Gold flowering 3	24.469
	CRR073318	Tawny withering 1	23.293
	CRR073319	Tawny withering 2	66.677
	CRR073320	Tawny withering 3	22.037