Gene detail

Detail information of GWHGAAZE025895

Functional Annotation

Database	Orthologs	E value	Annotation
Nr	XP_008375608.1	4.98096E-38	PREDICTED: cell division control protein 2 homolog [Malus domestica]
COG	YP_008089030.1	0.000003	Serine/threonine protein kinase
Swissprot	tr\|P93101\|CDC2_OXYRB	3E-38	Cell division control protein 2 homolog
trEMBL	tr\|W9SIR7\|W9SIR7_9ROSA	1E-37	Cell division control protein 2-A-like protein {ECO:0000313\|EMBL:EXC33643.1}
TAIR10	AT3G48750.1	5E-30	cell division control 2

Location And Transcript Sequence (JBrowse)

Scaffold	Type	Start	End	Strand
GWHAAZE00000007	gene	69775504	69778666	+
GWHAAZE00000007	mRNA	69775504	69778666	+
GWHAAZE00000007	exon	69775504	69775548	+
GWHAAZE00000007	exon	69778301	69778376	+
GWHAAZE00000007	exon	69778463	69778666	+
GWHAAZE00000007	five_prime_UTR	69775504	69775548	+
GWHAAZE00000007	five_prime_UTR	69778301	69778367	+
GWHAAZE00000007	CDS	69778368	69778376	+
GWHAAZE00000007	CDS	69778463	69778666	+

Transcript Sequence
>GWHTAAZE025929 TTTATTCGCTCCACTTTTTGCGCGAGACTGTGTGGGAGTTTACAGTTGCGACTTTCCTGGGGCTTTTCTTCTCTCTGCTCTAGAATCTCCATTGATCAGCGAGCAGAACTTTATGGACCAGTATGAAAAAGTTGAGAAGATTGGCGAAGGAACATATGGTGTGGTATACAAGGCTCGTGACCGAGTGACCAACAAAACAATTGCTTTGAAGAAGATCCGTCTGGAGCAGGAGGATGAGGGAGTCCCAAGCACAGCTATTAGAGAAATTTCTCTTCTGAAGGAGATGCAGCATGGAAACATTGTTAGGTATGCCCTTCGTGCTTAG

Network for GWHGAAZE025895

Network category	Network	Top300 PCC genelist
Coexpression Positive	Network	Top300 PCC genelist
Coexpression Negative	Network	Top300 PCC genelist

Functional Module

Module ID	Function Annotation

Protein Structure

Pfam accession	Pfam name	Alignment start	Alignment end	E-value
PF00069.26	Pkinase	4	66	8.70E-17

Protein Sequence

Gene family

Gene family	subfamily
Protein Kinases Family	CMGC_CDK-Pl

KEGG pathway

KO	Enzyme	pathway	mapID
K02206	CDK2	FoxO signaling pathway	map04068
		PI3K-Akt signaling pathway	map04151
		Cell cycle	map04110
		Oocyte meiosis	map04114
		p53 signaling pathway	map04115
		Cellular senescence	map04218
		Progesterone-mediated oocyte maturation	map04914

Gene Ontology

GO term	Ontology	Name
GO:0006468	biological_process	protein phosphorylation
GO:0005524	molecular_function	ATP binding
GO:0004672	molecular_function	protein kinase activity

Expression pattern

Expression pattern detail

SRP	Sample	Description	TPM
SRP075780	SRR3591705	youngest leaf	48.816
	SRR3591706	second leaf	27.137
	SRR3591707	mature leaf	19.587
	SRR3591708	Shoot apex	46.560
	SRR3591709	Stem	37.183
	SRR3591710	White floral bud	44.371
	SRR3591711	White flower	30.413
	SRR3591712	Green floral bud	48.823
	SRR3591713	Yellow flower	18.648
SRP173429	SRR8316895	Juvenile bud stage	18.065
	SRR8316896	Juvenile bud stage	28.303
	SRR8316897	Juvenile bud stage	12.741
	SRR8316894	Third green stage	12.560
	SRR8316900	Third green stage	39.249
	SRR8316901	Third green stage	39.753
	SRR8316898	Complete white stage	17.513
	SRR8316899	Complete white stage	54.261
	SRR8316903	Complete white stage	22.525
	SRR8316902	Silver flowering stage	11.751
	SRR8316904	Silver flowering stage	18.971
	SRR8316905	Silver flowering stage	9.125
	SRR8316906	Gold flowering stage	21.656
	SRR8316907	Gold flowering stage	24.835
	SRR8316908	Gold flowering stage	22.678
SRP132670	SRR6706286	Control	34.225
	SRR6706287	Light intensity 50%	29.627
	SRR6706288	Light intensity 20%	36.383
CNP0000432	CNS0095592	Slightly white alabastrum(diploid) 1	15.750
	CNS0095593	Slightly white alabastrum(diploid) 2	23.372
	CNS0095594	Slightly white alabastrum(diploid) 3	20.628
	CNS0095595	Whole white alabastrum(diploid) 2	29.114
	CNS0095596	Whole white alabastrum(diploid) 3	21.362
	CNS0095597	Whole white alabastrum(diploid) 4	25.780
	CNS0095598	Silvery flower (diploied) 1	22.388
	CNS0095599	Silvery flower (diploied) 2	23.766
	CNS0095600	Silvery flower (diploied) 3	23.410
	CNS0095601	Golden flower (diploid) 1	12.433
	CNS0095602	Golden flower (diploid) 2	22.816
	CNS0095603	Golden flower (diploid) 3	21.340
	CNS0095604	Slightly white alabastrum(tetraploid) 1	35.328
	CNS0095605	Slightly white alabastrum(tetraploid) 2	25.345
	CNS0095606	Slightly white alabastrum(tetraploid) 3	67.353
	CNS0095607	Whole white alabastrum(tetraploid) 1	22.977
	CNS0095608	Whole white alabastrum(tetraploid) 2	15.688
	CNS0095609	Whole white alabastrum(tetraploid) 3	47.425
	CNS0095610	Silvery flower (diploied) 1	30.054
	CNS0095611	Silvery flower (diploied) 2	30.962
	CNS0095612	Silvery flower (diploied) 3	22.734
	CNS0095613	Golden flower (tetraploid) 1	10.865
	CNS0095614	Golden flower (tetraploid) 2	24.035
	CNS0095615	Golden flower (tetraploid) 3	17.759
CRA001975	CRR073297	Stem 1	28.079
	CRR073298	Stem 2	25.610
	CRR073299	Stem 3	23.510
	CRR073300	Leaf 1	27.734
	CRR073301	Leaf 2	21.580
	CRR073302	Leaf 3	29.162
	CRR073303	Juvenile bud 1	30.041
	CRR073304	Juvenile bud 2	22.053
	CRR073305	Juvenile bud 3	29.440
	CRR073306	Third green 1	10.762
	CRR073307	Third green 2	19.037
	CRR073308	Third green 3	15.125
	CRR073309	Second white 1	10.840
	CRR073310	Second white 2	8.480
	CRR073311	Second white 3	6.676
	CRR073312	Silver flowering 1	10.752
	CRR073313	Silver flowering 2	5.068
	CRR073314	Silver flowering 3	5.242
	CRR073315	Gold flowering 1	13.488
	CRR073316	Gold flowering 2	13.305
	CRR073317	Gold flowering 3	11.974
	CRR073318	Tawny withering 1	21.657
	CRR073319	Tawny withering 2	8.724
	CRR073320	Tawny withering 3	20.797