Gene detail

Detail information of GWHGAAZE025999

Functional Annotation

Database	Orthologs	E value	Annotation
Nr	XP_011086444.1	3.6808E-102	PREDICTED: N-alpha-acetyltransferase 50 [Sesamum indicum]
COG	YP_004781726.1	9E-13	ribosomal-protein-alanine acetyltransferase
Swissprot	tr\|Q9M8T9\|MCC1_ARATH	6E-11	Histone acetyltransferase MCC1
trEMBL	tr\|A0A067KBN5\|A0A067KBN5_JATCU	2E-99	Uncharacterized protein {ECO:0000313\|EMBL:KDP33636.1}
TAIR10	AT5G11340.1	3E-72	Acyl-CoA N-acyltransferases (NAT) superfamily protein

Location And Transcript Sequence (JBrowse)

Scaffold	Type	Start	End	Strand
GWHAAZE00000007	gene	71595788	71602910	+
GWHAAZE00000007	mRNA	71595788	71602910	+
GWHAAZE00000007	exon	71595788	71595944	+
GWHAAZE00000007	exon	71599690	71599812	+
GWHAAZE00000007	exon	71602687	71602910	+
GWHAAZE00000007	CDS	71595788	71595944	+
GWHAAZE00000007	CDS	71599690	71599812	+
GWHAAZE00000007	CDS	71602687	71602910	+

Transcript Sequence
>GWHTAAZE026033 ATGGGGGCTGGGGGGAGAGAAGTACCAATAACTTTGGACGGGGTGAGAGAGAAGAATCTGATGCAACTCAAAAAGCTCAACGCTGCTCTCTTCCCCGTTCACTACAACGACAAATACTACGCCGACGCTCTCGCCTCCGGCGAATTCACTAAGCTAGCATATTACAGCGACATTTATGTGGGTGCAATTGCATGCCGGCTTGAGAAGAAGGAAGGCGGGTCAGTCCGTGTATACATAATGACACTGGGTGTTTTGGCGCCATATCGCGGCCTAGGTATTGGTACAAAGTTATTGAATCACGTTATTGATTTGTGCTCGAAGCAGCAAAACATAAGTGAGATCTACTTGCACGTGCAGACAAACAATGAAGATGCCATCAACTTTTACAAGAAATTCGGATTCGAAATCACGGACACAATCCACAATTATTACACAAACATTACTCCGCCAGATTGCTACATTGTTACCAAGTTCATCGGTGCTCAATCCCAATCAAAGAAGTAA

Network for GWHGAAZE025999

Network category	Network	Top300 PCC genelist
Coexpression Positive	Network	Top300 PCC genelist
Coexpression Negative	Network	Top300 PCC genelist

Functional Module

Module ID	Function Annotation

Protein Structure

Pfam accession	Pfam name	Alignment start	Alignment end	E-value
PF00583.26	Acetyltransf_1	49	134	4.60E-16

Protein Sequence

Gene family

Gene family	subfamily
Transcription Factors Family	GNAT

KEGG pathway

KO	Enzyme	pathway	mapID
--	--	--	--

Gene Ontology

GO term	Ontology	Name
GO:0008080	molecular_function	N-acetyltransferase activity

Expression pattern

Expression pattern detail

SRP	Sample	Description	TPM
SRP075780	SRR3591705	youngest leaf	57.373
	SRR3591706	second leaf	31.075
	SRR3591707	mature leaf	22.426
	SRR3591708	Shoot apex	58.668
	SRR3591709	Stem	46.578
	SRR3591710	White floral bud	25.117
	SRR3591711	White flower	36.451
	SRR3591712	Green floral bud	48.523
	SRR3591713	Yellow flower	40.123
SRP173429	SRR8316895	Juvenile bud stage	26.330
	SRR8316896	Juvenile bud stage	36.053
	SRR8316897	Juvenile bud stage	19.623
	SRR8316894	Third green stage	14.170
	SRR8316900	Third green stage	40.981
	SRR8316901	Third green stage	37.475
	SRR8316898	Complete white stage	12.932
	SRR8316899	Complete white stage	39.969
	SRR8316903	Complete white stage	20.765
	SRR8316902	Silver flowering stage	13.432
	SRR8316904	Silver flowering stage	15.947
	SRR8316905	Silver flowering stage	8.037
	SRR8316906	Gold flowering stage	27.995
	SRR8316907	Gold flowering stage	24.413
	SRR8316908	Gold flowering stage	24.778
SRP132670	SRR6706286	Control	55.968
	SRR6706287	Light intensity 50%	58.918
	SRR6706288	Light intensity 20%	48.936
CNP0000432	CNS0095592	Slightly white alabastrum(diploid) 1	53.816
	CNS0095593	Slightly white alabastrum(diploid) 2	55.035
	CNS0095594	Slightly white alabastrum(diploid) 3	60.466
	CNS0095595	Whole white alabastrum(diploid) 2	43.179
	CNS0095596	Whole white alabastrum(diploid) 3	55.054
	CNS0095597	Whole white alabastrum(diploid) 4	50.385
	CNS0095598	Silvery flower (diploied) 1	32.224
	CNS0095599	Silvery flower (diploied) 2	29.344
	CNS0095600	Silvery flower (diploied) 3	31.330
	CNS0095601	Golden flower (diploid) 1	29.542
	CNS0095602	Golden flower (diploid) 2	34.566
	CNS0095603	Golden flower (diploid) 3	35.460
	CNS0095604	Slightly white alabastrum(tetraploid) 1	66.949
	CNS0095605	Slightly white alabastrum(tetraploid) 2	66.789
	CNS0095606	Slightly white alabastrum(tetraploid) 3	70.724
	CNS0095607	Whole white alabastrum(tetraploid) 1	51.555
	CNS0095608	Whole white alabastrum(tetraploid) 2	48.261
	CNS0095609	Whole white alabastrum(tetraploid) 3	56.852
	CNS0095610	Silvery flower (diploied) 1	37.265
	CNS0095611	Silvery flower (diploied) 2	28.418
	CNS0095612	Silvery flower (diploied) 3	30.533
	CNS0095613	Golden flower (tetraploid) 1	32.798
	CNS0095614	Golden flower (tetraploid) 2	33.915
	CNS0095615	Golden flower (tetraploid) 3	23.610
CRA001975	CRR073297	Stem 1	61.329
	CRR073298	Stem 2	62.993
	CRR073299	Stem 3	58.439
	CRR073300	Leaf 1	51.599
	CRR073301	Leaf 2	50.204
	CRR073302	Leaf 3	66.525
	CRR073303	Juvenile bud 1	52.096
	CRR073304	Juvenile bud 2	42.121
	CRR073305	Juvenile bud 3	35.709
	CRR073306	Third green 1	22.073
	CRR073307	Third green 2	23.164
	CRR073308	Third green 3	17.704
	CRR073309	Second white 1	32.438
	CRR073310	Second white 2	24.303
	CRR073311	Second white 3	22.396
	CRR073312	Silver flowering 1	28.953
	CRR073313	Silver flowering 2	29.960
	CRR073314	Silver flowering 3	22.930
	CRR073315	Gold flowering 1	43.506
	CRR073316	Gold flowering 2	39.454
	CRR073317	Gold flowering 3	26.809
	CRR073318	Tawny withering 1	77.490
	CRR073319	Tawny withering 2	74.393
	CRR073320	Tawny withering 3	71.304