Gene detail

Detail information of GWHGAAZE026527

Functional Annotation

Database	Orthologs	E value	Annotation
Nr	XP_004240892.1	1.5195E-131	PREDICTED: arogenate dehydrogenase 1, chloroplastic-like [Solanum lycopersicum]
COG	YP_005036431.1	1E-30	putative prephenate dehydrogenase
Swissprot	tr\|Q944B6\|TYRA1_ARATH	4E-90	Arogenate dehydrogenase 1, chloroplastic (Precursor)
trEMBL	tr\|K4C5K7\|K4C5K7_SOLLC	6E-132	Uncharacterized protein {ECO:0000313\|EnsemblPlants:Solyc06g050630.2.1}
TAIR10	AT5G34930.1	6E-76	arogenate dehydrogenase

Location And Transcript Sequence (JBrowse)

Scaffold	Type	Start	End	Strand
GWHAAZE00000008	gene	5991630	5994619	+
GWHAAZE00000008	mRNA	5991630	5994619	+
GWHAAZE00000008	exon	5991630	5991808	+
GWHAAZE00000008	exon	5992909	5993077	+
GWHAAZE00000008	exon	5993198	5993353	+
GWHAAZE00000008	exon	5994167	5994249	+
GWHAAZE00000008	exon	5994339	5994408	+
GWHAAZE00000008	exon	5994518	5994619	+
GWHAAZE00000008	CDS	5991630	5991808	+
GWHAAZE00000008	CDS	5992909	5993077	+
GWHAAZE00000008	CDS	5993198	5993353	+
GWHAAZE00000008	CDS	5994167	5994249	+
GWHAAZE00000008	CDS	5994339	5994408	+
GWHAAZE00000008	CDS	5994518	5994619	+

Transcript Sequence
>GWHTAAZE026561 ATGTCGTCTTCTTCCTTCTCATCAACATCAGCAAAAAAACTGAAAATAGGGATAATTGGGTTCGGGTCCTTTGCGCATTTTCTGGCAATAACAATGATTAAACAAGGTCACTCTGTATCTGCTACTTCCAGATCCGATTATTCCCAACTCTCCCGCTCTATGGGTATCTCCTTCTTCAGGGATATGGAGTCATTTATCCGGTCGGAACAGGACGTCTTTCTGATATCAACATCAATACTGTCACTGTCGGAGGTGGTTAATTCAATTCCGTTCAGCTGCCTGAAACGGCCGACGCTATTCGCGGATGTTCTATCGGTTAAAGAACACCCTAGAGATATTCTACTCAAAGCAGTGCCGGAGGAGTCAGATGTGCTTTGTACTCATCCGATGTTCGGGCCGGAAAGTGGGAAAGATGGATGGAAAGATTTAACCTTTGTATATGACAGAGTTCGAATCCGAGATGAAACTATTTCCTCTGCTTTCCTCCATATTTTCCAATCTGAGGGTTGCAAAATGGTGGAAATGAGTTGTGAAGAGCATGATAAATTAGCTGCTAGAAGCCAATTTCTTACTCACACCATTGGCAGGATCTTGTCAGAAATGGAGATTGAATCCACCTCTATTGACACAAAGGGATTCCAAAAGCTTGTTGAATTGAAAGAAAGCACAACAAAAGATAGTTTTGATCTGTTTAGTGGGTTATTCGTTCATAACAGATTTGCCCATCAGCAGGCATGCAACTACTTTCTTATACCATAA

Network for GWHGAAZE026527

Network category	Network	Top300 PCC genelist
Coexpression Positive	Network	Top300 PCC genelist
Coexpression Negative	Network	Top300 PCC genelist

Functional Module

Module ID	Function Annotation

Protein Structure

Pfam accession	Pfam name	Alignment start	Alignment end	E-value
PF02153.18	PDH	35	207	3.50E-13

Protein Sequence

Gene family

Gene family	subfamily
--	--

KEGG pathway

KO	Enzyme	pathway	mapID
K15227	TYRAAT	Metabolic pathways	map01100
		Biosynthesis of secondary metabolites	map01110
		Biosynthesis of amino acids	map01230
		Phenylalanine, tyrosine and tryptophan biosynthesis	map00400

Gene Ontology

GO term	Ontology	Name
GO:0006571	biological_process	tyrosine biosynthetic process
GO:0055114	biological_process	oxidation-reduction process
GO:0004665	molecular_function	prephenate dehydrogenase (NADP+) activity
GO:0008977	molecular_function	prephenate dehydrogenase (NAD+) activity

Expression pattern

Expression pattern detail

SRP	Sample	Description	TPM
SRP075780	SRR3591705	youngest leaf	7.342
	SRR3591706	second leaf	2.191
	SRR3591707	mature leaf	5.365
	SRR3591708	Shoot apex	3.688
	SRR3591709	Stem	4.965
	SRR3591710	White floral bud	4.169
	SRR3591711	White flower	2.541
	SRR3591712	Green floral bud	4.570
	SRR3591713	Yellow flower	22.593
SRP173429	SRR8316895	Juvenile bud stage	2.139
	SRR8316896	Juvenile bud stage	3.708
	SRR8316897	Juvenile bud stage	1.219
	SRR8316894	Third green stage	0.885
	SRR8316900	Third green stage	2.509
	SRR8316901	Third green stage	3.513
	SRR8316898	Complete white stage	1.750
	SRR8316899	Complete white stage	6.867
	SRR8316903	Complete white stage	2.356
	SRR8316902	Silver flowering stage	1.006
	SRR8316904	Silver flowering stage	2.336
	SRR8316905	Silver flowering stage	0.851
	SRR8316906	Gold flowering stage	1.849
	SRR8316907	Gold flowering stage	0.771
	SRR8316908	Gold flowering stage	0.339
SRP132670	SRR6706286	Control	1.199
	SRR6706287	Light intensity 50%	1.179
	SRR6706288	Light intensity 20%	1.486
CNP0000432	CNS0095592	Slightly white alabastrum(diploid) 1	3.629
	CNS0095593	Slightly white alabastrum(diploid) 2	4.099
	CNS0095594	Slightly white alabastrum(diploid) 3	2.825
	CNS0095595	Whole white alabastrum(diploid) 2	2.514
	CNS0095596	Whole white alabastrum(diploid) 3	2.720
	CNS0095597	Whole white alabastrum(diploid) 4	6.483
	CNS0095598	Silvery flower (diploied) 1	3.049
	CNS0095599	Silvery flower (diploied) 2	6.329
	CNS0095600	Silvery flower (diploied) 3	2.869
	CNS0095601	Golden flower (diploid) 1	3.790
	CNS0095602	Golden flower (diploid) 2	3.423
	CNS0095603	Golden flower (diploid) 3	3.205
	CNS0095604	Slightly white alabastrum(tetraploid) 1	1.490
	CNS0095605	Slightly white alabastrum(tetraploid) 2	2.357
	CNS0095606	Slightly white alabastrum(tetraploid) 3	4.429
	CNS0095607	Whole white alabastrum(tetraploid) 1	1.077
	CNS0095608	Whole white alabastrum(tetraploid) 2	3.672
	CNS0095609	Whole white alabastrum(tetraploid) 3	2.024
	CNS0095610	Silvery flower (diploied) 1	1.872
	CNS0095611	Silvery flower (diploied) 2	0.854
	CNS0095612	Silvery flower (diploied) 3	1.274
	CNS0095613	Golden flower (tetraploid) 1	1.704
	CNS0095614	Golden flower (tetraploid) 2	2.816
	CNS0095615	Golden flower (tetraploid) 3	2.379
CRA001975	CRR073297	Stem 1	5.266
	CRR073298	Stem 2	4.492
	CRR073299	Stem 3	3.942
	CRR073300	Leaf 1	6.976
	CRR073301	Leaf 2	7.351
	CRR073302	Leaf 3	4.844
	CRR073303	Juvenile bud 1	6.953
	CRR073304	Juvenile bud 2	8.554
	CRR073305	Juvenile bud 3	8.237
	CRR073306	Third green 1	1.405
	CRR073307	Third green 2	1.842
	CRR073308	Third green 3	1.135
	CRR073309	Second white 1	0.509
	CRR073310	Second white 2	0.877
	CRR073311	Second white 3	0.727
	CRR073312	Silver flowering 1	0.895
	CRR073313	Silver flowering 2	0.484
	CRR073314	Silver flowering 3	0.974
	CRR073315	Gold flowering 1	1.179
	CRR073316	Gold flowering 2	2.250
	CRR073317	Gold flowering 3	1.301
	CRR073318	Tawny withering 1	5.483
	CRR073319	Tawny withering 2	5.842
	CRR073320	Tawny withering 3	4.131