Gene detail

Detail information of GWHGAAZE026573

Functional Annotation

Database	Orthologs	E value	Annotation
Nr	XP_009792865.1	4.67243E-08	PREDICTED: tryptophan synthase beta chain 1 [Nicotiana sylvestris]
Swissprot	tr\|O50046\|TRPB_CAMAC	0.000001	Tryptophan synthase beta chain 2, chloroplastic (Precursor)
trEMBL	tr\|K4CHA9\|K4CHA9_SOLLC	0.00000002	Uncharacterized protein {ECO:0000313\|EnsemblPlants:Solyc07g064280.2.1}
TAIR10	AT5G54810.1	0.0007	tryptophan synthase beta-subunit 1

Location And Transcript Sequence (JBrowse)

Scaffold	Type	Start	End	Strand
GWHAAZE00000008	gene	6725046	6725264	+
GWHAAZE00000008	mRNA	6725046	6725264	+
GWHAAZE00000008	exon	6725046	6725264	+
GWHAAZE00000008	CDS	6725046	6725264	+

Transcript Sequence
>GWHTAAZE026607 ATGTCTTGCCCTTCCTTCACCACCAAAACCCCTTCTATATCCTGTGTTCTCACCGGTAATTCGGCTCAGTCAACAATGGGCCAAGAAGCTGAACCGCTTCTCCTTCGCCCCGACTCCTTCGACCGCTTCGGCAAGTTCGGTGGCAAGTACGTTCGAAACCCTTATGCATTCTCTCACTCAGCTCGAAGCCGCTTTTCATTTACTCGCTGGGGACCATGA

Network for GWHGAAZE026573

Network category	Network	Top300 PCC genelist
Coexpression Positive	Network	Top300 PCC genelist
Coexpression Negative	Network	Top300 PCC genelist

Functional Module

Module ID	Function Annotation

Protein Structure

Pfam accession	Pfam name	Alignment start	Alignment end	E-value
--	--	--	--	--

Protein Sequence

Gene family

Gene family	subfamily
--	--

KEGG pathway

KO	Enzyme	pathway	mapID
K01696	trpB	Metabolic pathways	map01100
		Biosynthesis of secondary metabolites	map01110
		Biosynthesis of amino acids	map01230
		Glycine, serine and threonine metabolism	map00260
		Phenylalanine, tyrosine and tryptophan biosynthesis	map00400

Gene Ontology

GO term	Ontology	Name

Expression pattern

Expression pattern detail

SRP	Sample	Description	TPM
SRP075780	SRR3591705	youngest leaf	0.000
	SRR3591706	second leaf	0.624
	SRR3591707	mature leaf	0.000
	SRR3591708	Shoot apex	0.449
	SRR3591709	Stem	0.182
	SRR3591710	White floral bud	0.571
	SRR3591711	White flower	0.819
	SRR3591712	Green floral bud	0.120
	SRR3591713	Yellow flower	0.517
SRP173429	SRR8316895	Juvenile bud stage	0.410
	SRR8316896	Juvenile bud stage	0.152
	SRR8316897	Juvenile bud stage	0.410
	SRR8316894	Third green stage	0.000
	SRR8316900	Third green stage	0.531
	SRR8316901	Third green stage	0.445
	SRR8316898	Complete white stage	0.000
	SRR8316899	Complete white stage	0.149
	SRR8316903	Complete white stage	0.000
	SRR8316902	Silver flowering stage	0.237
	SRR8316904	Silver flowering stage	0.155
	SRR8316905	Silver flowering stage	0.222
	SRR8316906	Gold flowering stage	0.150
	SRR8316907	Gold flowering stage	0.792
	SRR8316908	Gold flowering stage	0.319
SRP132670	SRR6706286	Control	1.188
	SRR6706287	Light intensity 50%	0.614
	SRR6706288	Light intensity 20%	0.426
CNP0000432	CNS0095592	Slightly white alabastrum(diploid) 1	0.398
	CNS0095593	Slightly white alabastrum(diploid) 2	0.281
	CNS0095594	Slightly white alabastrum(diploid) 3	0.740
	CNS0095595	Whole white alabastrum(diploid) 2	0.075
	CNS0095596	Whole white alabastrum(diploid) 3	0.000
	CNS0095597	Whole white alabastrum(diploid) 4	0.000
	CNS0095598	Silvery flower (diploied) 1	0.000
	CNS0095599	Silvery flower (diploied) 2	0.000
	CNS0095600	Silvery flower (diploied) 3	0.245
	CNS0095601	Golden flower (diploid) 1	0.000
	CNS0095602	Golden flower (diploid) 2	0.000
	CNS0095603	Golden flower (diploid) 3	0.000
	CNS0095604	Slightly white alabastrum(tetraploid) 1	0.000
	CNS0095605	Slightly white alabastrum(tetraploid) 2	0.000
	CNS0095606	Slightly white alabastrum(tetraploid) 3	0.078
	CNS0095607	Whole white alabastrum(tetraploid) 1	0.000
	CNS0095608	Whole white alabastrum(tetraploid) 2	0.000
	CNS0095609	Whole white alabastrum(tetraploid) 3	0.000
	CNS0095610	Silvery flower (diploied) 1	0.000
	CNS0095611	Silvery flower (diploied) 2	0.000
	CNS0095612	Silvery flower (diploied) 3	0.000
	CNS0095613	Golden flower (tetraploid) 1	0.000
	CNS0095614	Golden flower (tetraploid) 2	0.058
	CNS0095615	Golden flower (tetraploid) 3	0.000
CRA001975	CRR073297	Stem 1	0.190
	CRR073298	Stem 2	0.000
	CRR073299	Stem 3	0.585
	CRR073300	Leaf 1	0.117
	CRR073301	Leaf 2	0.233
	CRR073302	Leaf 3	0.155
	CRR073303	Juvenile bud 1	0.000
	CRR073304	Juvenile bud 2	0.230
	CRR073305	Juvenile bud 3	0.131
	CRR073306	Third green 1	0.199
	CRR073307	Third green 2	0.000
	CRR073308	Third green 3	0.000
	CRR073309	Second white 1	0.000
	CRR073310	Second white 2	1.008
	CRR073311	Second white 3	0.481
	CRR073312	Silver flowering 1	0.396
	CRR073313	Silver flowering 2	0.890
	CRR073314	Silver flowering 3	0.179
	CRR073315	Gold flowering 1	1.250
	CRR073316	Gold flowering 2	0.846
	CRR073317	Gold flowering 3	2.036
	CRR073318	Tawny withering 1	0.978
	CRR073319	Tawny withering 2	2.637
	CRR073320	Tawny withering 3	0.051