Gene detail

Detail information of GWHGAAZE026843

Functional Annotation

Database	Orthologs	E value	Annotation
Nr	XP_006367798.1	2.75727E-60	PREDICTED: ethylene-responsive transcription factor 4-like [Solanum tuberosum]
Swissprot	tr\|Q9LW49\|ERF4_NICSY	2E-58	Ethylene-responsive transcription factor 4
trEMBL	tr\|M1CJQ8\|M1CJQ8_SOLTU	1E-60	Uncharacterized protein {ECO:0000313\|EnsemblPlants:PGSC0003DMT400068959}
TAIR10	AT5G44210.1	2E-24	erf domain protein 9

Location And Transcript Sequence (JBrowse)

Scaffold	Type	Start	End	Strand
GWHAAZE00000008	gene	10879741	10880349	+
GWHAAZE00000008	mRNA	10879741	10880349	+
GWHAAZE00000008	exon	10879741	10880349	+
GWHAAZE00000008	CDS	10879741	10880349	+

Transcript Sequence
>GWHTAAZE026877 ATGACTATGAAAGACAAAGCTAACGTAGTTAAGGTATCCAACAAGGAGGTGCATTACAGAGGAGTGAGAAAGCGCCCGTGGGGACGATACGCAGCCGAAATCCGAGATCCGTCAAAGAAGAGCCGCGTCTGGTTAGGCACCTTCGACACTGCGGAGGCTGCCGCCAGAGCCTACGATGCCGCAGCCATCGAGTTCCGAGGCACCAAGGCCAAGACCAACTTCCCACCACCGTCAGATACCGACCACAGCCCAAGCCAGAGCAGCACTGTTGAGTCCACCACACCCCACGCGCCGCTAGAGCTTGACCTCACCCGAAGCCTTGGTCACGGTGAGGATGTTGTGGTTGGGTATTATTACAACCAACAGCAGGCGGTGTTGCCGCAGGGTTATCCCGTGTTGTTTTTTGACGCGCTTGTGCGGCCGGGCTTTGCAAGTGGGGGACAACCGTACCGGTTTGACTTACCGGTTACTGAGTTGAATGGTGGGACCCAGAGTGAGTCGGACTCGTCCTCTGTTGTTGTCGATGGGAATTATCAAAAGGATATGAGCCGTCGGATAGGGGTTATCGATCTGGATCTTAATTTAGCTCCGCCCATGGAAGCAAATTGA

Network for GWHGAAZE026843

Network category	Network	Top300 PCC genelist
Coexpression Positive	Network	Top300 PCC genelist
Coexpression Negative	Network	Top300 PCC genelist

Functional Module

Module ID	Function Annotation

Protein Structure

Pfam accession	Pfam name	Alignment start	Alignment end	E-value
PF00847.21	AP2	18	67	6.60E-15

Protein Sequence

Gene family

Gene family	subfamily
Transcription Factors Family	AP2/ERF-ERF

KEGG pathway

KO	Enzyme	pathway	mapID
--	--	--	--

Gene Ontology

GO term	Ontology	Name
GO:0006355	biological_process	regulation of transcription, DNA-templated
GO:0003700	molecular_function	DNA-binding transcription factor activity
GO:0003677	molecular_function	DNA binding

Expression pattern

Expression pattern detail

SRP	Sample	Description	TPM
SRP075780	SRR3591705	youngest leaf	86.865
	SRR3591706	second leaf	10.713
	SRR3591707	mature leaf	4.738
	SRR3591708	Shoot apex	76.362
	SRR3591709	Stem	72.349
	SRR3591710	White floral bud	42.570
	SRR3591711	White flower	64.150
	SRR3591712	Green floral bud	36.868
	SRR3591713	Yellow flower	31.555
SRP173429	SRR8316895	Juvenile bud stage	45.821
	SRR8316896	Juvenile bud stage	19.194
	SRR8316897	Juvenile bud stage	33.343
	SRR8316894	Third green stage	9.751
	SRR8316900	Third green stage	18.796
	SRR8316901	Third green stage	24.113
	SRR8316898	Complete white stage	0.415
	SRR8316899	Complete white stage	67.413
	SRR8316903	Complete white stage	0.480
	SRR8316902	Silver flowering stage	0.423
	SRR8316904	Silver flowering stage	0.244
	SRR8316905	Silver flowering stage	0.423
	SRR8316906	Gold flowering stage	1.736
	SRR8316907	Gold flowering stage	0.844
	SRR8316908	Gold flowering stage	1.079
SRP132670	SRR6706286	Control	5.919
	SRR6706287	Light intensity 50%	7.805
	SRR6706288	Light intensity 20%	5.124
CNP0000432	CNS0095592	Slightly white alabastrum(diploid) 1	101.959
	CNS0095593	Slightly white alabastrum(diploid) 2	139.674
	CNS0095594	Slightly white alabastrum(diploid) 3	135.823
	CNS0095595	Whole white alabastrum(diploid) 2	88.749
	CNS0095596	Whole white alabastrum(diploid) 3	10.311
	CNS0095597	Whole white alabastrum(diploid) 4	50.974
	CNS0095598	Silvery flower (diploied) 1	170.815
	CNS0095599	Silvery flower (diploied) 2	160.004
	CNS0095600	Silvery flower (diploied) 3	52.995
	CNS0095601	Golden flower (diploid) 1	228.936
	CNS0095602	Golden flower (diploid) 2	144.387
	CNS0095603	Golden flower (diploid) 3	132.713
	CNS0095604	Slightly white alabastrum(tetraploid) 1	0.056
	CNS0095605	Slightly white alabastrum(tetraploid) 2	0.294
	CNS0095606	Slightly white alabastrum(tetraploid) 3	0.831
	CNS0095607	Whole white alabastrum(tetraploid) 1	0.222
	CNS0095608	Whole white alabastrum(tetraploid) 2	0.363
	CNS0095609	Whole white alabastrum(tetraploid) 3	0.219
	CNS0095610	Silvery flower (diploied) 1	0.606
	CNS0095611	Silvery flower (diploied) 2	0.216
	CNS0095612	Silvery flower (diploied) 3	5.553
	CNS0095613	Golden flower (tetraploid) 1	0.296
	CNS0095614	Golden flower (tetraploid) 2	0.178
	CNS0095615	Golden flower (tetraploid) 3	0.220
CRA001975	CRR073297	Stem 1	60.795
	CRR073298	Stem 2	60.121
	CRR073299	Stem 3	67.898
	CRR073300	Leaf 1	113.725
	CRR073301	Leaf 2	172.620
	CRR073302	Leaf 3	89.533
	CRR073303	Juvenile bud 1	87.344
	CRR073304	Juvenile bud 2	85.905
	CRR073305	Juvenile bud 3	116.910
	CRR073306	Third green 1	12.824
	CRR073307	Third green 2	16.608
	CRR073308	Third green 3	11.782
	CRR073309	Second white 1	4.126
	CRR073310	Second white 2	8.726
	CRR073311	Second white 3	8.462
	CRR073312	Silver flowering 1	35.895
	CRR073313	Silver flowering 2	21.228
	CRR073314	Silver flowering 3	10.592
	CRR073315	Gold flowering 1	30.596
	CRR073316	Gold flowering 2	48.319
	CRR073317	Gold flowering 3	43.234
	CRR073318	Tawny withering 1	22.221
	CRR073319	Tawny withering 2	107.501
	CRR073320	Tawny withering 3	24.383