Gene detail

Detail information of GWHGAAZE027539

Functional Annotation

Database	Orthologs	E value	Annotation
Nr	XP_009800798.1	6.01494E-62	PREDICTED: E3 ubiquitin-protein ligase RHA1B [Nicotiana sylvestris]
Swissprot	tr\|Q9SUS5\|RHA1B_ARATH	4E-20	E3 ubiquitin-protein ligase RHA1B
trEMBL	tr\|M1AW79\|M1AW79_SOLTU	2E-61	Uncharacterized protein {ECO:0000313\|EnsemblPlants:PGSC0003DMT400031780}
TAIR10	AT3G61460.1	3E-39	brassinosteroid-responsive RING-H2

Location And Transcript Sequence (JBrowse)

Scaffold	Type	Start	End	Strand
GWHAAZE00000008	gene	21763964	21764457	+
GWHAAZE00000008	mRNA	21763964	21764457	+
GWHAAZE00000008	exon	21763964	21764035	+
GWHAAZE00000008	exon	21764137	21764457	+
GWHAAZE00000008	CDS	21763964	21764035	+
GWHAAZE00000008	CDS	21764137	21764457	+

Transcript Sequence
>GWHTAAZE027573 ATGGGATTTCCAGTAGGCTGCACAGATCTCTTCCTCCCAAAGCTCTTCTTCTACACACTCTCTCTCCTCTCTCCCCGATCCGTATCCGCCGTGCTGATCCGCGAGCTCCTCCCCGTCGTCAAATTCTCCGATCTCGTCGATGCGCCGGGGACATGCGCTGTTTGCCTGTACGAGTTCGATTCCGGCGACGAGATCCGGCGGCTGACGAATTGCCGGCACGTGTTCCACAGGAGCTGCCTGGACCGTTGGATGGACCACGATCGGAACACGTGTCCGCTCTGTAGGTCTCCGTTTATCGCCGATGATTTGCAGGATAGTTTTAATGAGAGGCTATGGGCTGCTTCGGGGATCGGAGAACTTTACGGCGAGTATTCTCCGATTACTGGTTTATAA

Network for GWHGAAZE027539

Network category	Network	Top300 PCC genelist
Coexpression Positive	Network	Top300 PCC genelist
Coexpression Negative	Network	Top300 PCC genelist

Functional Module

Module ID	Function Annotation

Protein Structure

Pfam accession	Pfam name	Alignment start	Alignment end	E-value
PF13639.7	zf-RING_2	51	95	3.20E-14

Protein Sequence

Gene family

Gene family	subfamily
Ubiquitin Family	RING
Ubiquitin Family	U-box

KEGG pathway

KO	Enzyme	pathway	mapID
--	--	--	--

Gene Ontology

GO term	Ontology	Name
GO:0008270	molecular_function	zinc ion binding

Expression pattern

Expression pattern detail

SRP	Sample	Description	TPM
SRP075780	SRR3591705	youngest leaf	46.793
	SRR3591706	second leaf	19.339
	SRR3591707	mature leaf	10.464
	SRR3591708	Shoot apex	24.162
	SRR3591709	Stem	24.684
	SRR3591710	White floral bud	14.055
	SRR3591711	White flower	11.200
	SRR3591712	Green floral bud	21.985
	SRR3591713	Yellow flower	8.253
SRP173429	SRR8316895	Juvenile bud stage	10.910
	SRR8316896	Juvenile bud stage	28.210
	SRR8316897	Juvenile bud stage	13.261
	SRR8316894	Third green stage	6.231
	SRR8316900	Third green stage	8.394
	SRR8316901	Third green stage	14.569
	SRR8316898	Complete white stage	5.008
	SRR8316899	Complete white stage	28.579
	SRR8316903	Complete white stage	5.592
	SRR8316902	Silver flowering stage	2.895
	SRR8316904	Silver flowering stage	4.227
	SRR8316905	Silver flowering stage	3.100
	SRR8316906	Gold flowering stage	7.452
	SRR8316907	Gold flowering stage	4.033
	SRR8316908	Gold flowering stage	6.409
SRP132670	SRR6706286	Control	10.592
	SRR6706287	Light intensity 50%	8.569
	SRR6706288	Light intensity 20%	9.067
CNP0000432	CNS0095592	Slightly white alabastrum(diploid) 1	28.123
	CNS0095593	Slightly white alabastrum(diploid) 2	23.229
	CNS0095594	Slightly white alabastrum(diploid) 3	38.619
	CNS0095595	Whole white alabastrum(diploid) 2	13.986
	CNS0095596	Whole white alabastrum(diploid) 3	23.825
	CNS0095597	Whole white alabastrum(diploid) 4	13.973
	CNS0095598	Silvery flower (diploied) 1	10.019
	CNS0095599	Silvery flower (diploied) 2	5.020
	CNS0095600	Silvery flower (diploied) 3	9.824
	CNS0095601	Golden flower (diploid) 1	4.724
	CNS0095602	Golden flower (diploid) 2	5.599
	CNS0095603	Golden flower (diploid) 3	5.235
	CNS0095604	Slightly white alabastrum(tetraploid) 1	32.598
	CNS0095605	Slightly white alabastrum(tetraploid) 2	24.559
	CNS0095606	Slightly white alabastrum(tetraploid) 3	39.732
	CNS0095607	Whole white alabastrum(tetraploid) 1	20.329
	CNS0095608	Whole white alabastrum(tetraploid) 2	19.915
	CNS0095609	Whole white alabastrum(tetraploid) 3	16.189
	CNS0095610	Silvery flower (diploied) 1	8.341
	CNS0095611	Silvery flower (diploied) 2	13.205
	CNS0095612	Silvery flower (diploied) 3	3.769
	CNS0095613	Golden flower (tetraploid) 1	3.730
	CNS0095614	Golden flower (tetraploid) 2	8.435
	CNS0095615	Golden flower (tetraploid) 3	3.784
CRA001975	CRR073297	Stem 1	22.534
	CRR073298	Stem 2	24.185
	CRR073299	Stem 3	25.602
	CRR073300	Leaf 1	15.459
	CRR073301	Leaf 2	20.347
	CRR073302	Leaf 3	25.755
	CRR073303	Juvenile bud 1	30.986
	CRR073304	Juvenile bud 2	19.473
	CRR073305	Juvenile bud 3	48.424
	CRR073306	Third green 1	8.842
	CRR073307	Third green 2	11.774
	CRR073308	Third green 3	7.567
	CRR073309	Second white 1	2.938
	CRR073310	Second white 2	1.503
	CRR073311	Second white 3	0.498
	CRR073312	Silver flowering 1	0.163
	CRR073313	Silver flowering 2	0.579
	CRR073314	Silver flowering 3	0.300
	CRR073315	Gold flowering 1	6.648
	CRR073316	Gold flowering 2	5.222
	CRR073317	Gold flowering 3	10.371
	CRR073318	Tawny withering 1	11.862
	CRR073319	Tawny withering 2	9.685
	CRR073320	Tawny withering 3	7.560