Gene detail

Detail information of GWHGAAZE027747

Functional Annotation

Database	Orthologs	E value	Annotation
Nr	XP_010053502.1	2.55302E-92	PREDICTED: transcription factor MYB114-like [Eucalyptus grandis]
Swissprot	tr\|P10290\|MYBC_MAIZE	5E-53	Anthocyanin regulatory C1 protein
trEMBL	tr\|A0A059CIQ3\|A0A059CIQ3_EUCGR	1E-92	Uncharacterized protein {ECO:0000313\|EMBL:KCW77810.1}
TAIR10	AT5G40330.1	5E-42	myb domain protein 23

Location And Transcript Sequence (JBrowse)

Scaffold	Type	Start	End	Strand
GWHAAZE00000008	gene	26865549	26869046	-
GWHAAZE00000008	mRNA	26865549	26869046	-
GWHAAZE00000008	exon	26865549	26865852	-
GWHAAZE00000008	exon	26868337	26868466	-
GWHAAZE00000008	exon	26868911	26869046	-
GWHAAZE00000008	CDS	26868911	26869046	-
GWHAAZE00000008	CDS	26868337	26868466	-
GWHAAZE00000008	CDS	26865549	26865852	-

Transcript Sequence
>GWHTAAZE027781 ATGGTTAGGAAAAATGATGGGTGTGGTAAAAAGGTTTTCAACAGAGGAGCATGGACAGCTGAGGAAGACACAAAACTGGCTGGGTATATTGAAGTCCATGGTGCAAAGAAGTGGAGAACTGTAGCTACCAAGTCAGGCTTGAATAGATGCGGGAAGAGTTGTAGGTTGAGATGGTTGAATTATCTAAGACCAAATATCAAGAGAGGGAACATATCTGATGAAGAAGAGGACTTGATACTTAGGCTTCACAAGCTACTTGGAAACAGGTGGTCCTTGATTGCAGGAAGGCTTCCGGGGAGAACAGATAATGAGATCAAGAATCATTGGAACTCTCATTTGAGCAGAAAGTTGAATCAAAAAGAAGAAACTACTTTATCAGTACAAGATACATCGCGAGAGAGGCCAGTGAGTATAGTGAATGAAGAGAAAGAACAGTTCGAAGGAAGTGGAGACGCGGATATTAGCATTGATGTGAACGAATTCTTTGATTTTTCAAGCGAAGGGACCTATGGATTGGAGTGGGTAAACAAATTTCTTGAACTAGAAGAAGATCAACAAGCTCCCGAATAA

Network for GWHGAAZE027747

Network category	Network	Top300 PCC genelist
Coexpression Positive	Network	Top300 PCC genelist
Coexpression Negative	Network	Top300 PCC genelist

Functional Module

Module ID	Function Annotation

Protein Structure

Pfam accession	Pfam name	Alignment start	Alignment end	E-value
PF00249.32	Myb_DNA-binding	15	62	2.00E-15
PF00249.32	Myb_DNA-binding	68	113	1.20E-14

Protein Sequence

Gene family

Gene family	subfamily
Transcription Factors Family	MYB

KEGG pathway

KO	Enzyme	pathway	mapID
--	--	--	--

Gene Ontology

GO term	Ontology	Name
GO:0003677	molecular_function	DNA binding

Expression pattern

Expression pattern detail

SRP	Sample	Description	TPM
SRP075780	SRR3591705	youngest leaf	2.087
	SRR3591706	second leaf	0.000
	SRR3591707	mature leaf	0.000
	SRR3591708	Shoot apex	0.383
	SRR3591709	Stem	20.480
	SRR3591710	White floral bud	1.674
	SRR3591711	White flower	1.018
	SRR3591712	Green floral bud	1.494
	SRR3591713	Yellow flower	0.241
SRP173429	SRR8316895	Juvenile bud stage	5.756
	SRR8316896	Juvenile bud stage	2.605
	SRR8316897	Juvenile bud stage	1.371
	SRR8316894	Third green stage	1.627
	SRR8316900	Third green stage	0.998
	SRR8316901	Third green stage	0.925
	SRR8316898	Complete white stage	0.273
	SRR8316899	Complete white stage	4.365
	SRR8316903	Complete white stage	1.492
	SRR8316902	Silver flowering stage	2.085
	SRR8316904	Silver flowering stage	2.111
	SRR8316905	Silver flowering stage	1.169
	SRR8316906	Gold flowering stage	5.446
	SRR8316907	Gold flowering stage	5.349
	SRR8316908	Gold flowering stage	1.823
SRP132670	SRR6706286	Control	0.321
	SRR6706287	Light intensity 50%	0.636
	SRR6706288	Light intensity 20%	0.570
CNP0000432	CNS0095592	Slightly white alabastrum(diploid) 1	6.619
	CNS0095593	Slightly white alabastrum(diploid) 2	2.217
	CNS0095594	Slightly white alabastrum(diploid) 3	3.446
	CNS0095595	Whole white alabastrum(diploid) 2	2.743
	CNS0095596	Whole white alabastrum(diploid) 3	0.417
	CNS0095597	Whole white alabastrum(diploid) 4	0.642
	CNS0095598	Silvery flower (diploied) 1	3.136
	CNS0095599	Silvery flower (diploied) 2	2.560
	CNS0095600	Silvery flower (diploied) 3	1.687
	CNS0095601	Golden flower (diploid) 1	4.754
	CNS0095602	Golden flower (diploid) 2	1.287
	CNS0095603	Golden flower (diploid) 3	0.898
	CNS0095604	Slightly white alabastrum(tetraploid) 1	3.125
	CNS0095605	Slightly white alabastrum(tetraploid) 2	4.222
	CNS0095606	Slightly white alabastrum(tetraploid) 3	6.389
	CNS0095607	Whole white alabastrum(tetraploid) 1	2.668
	CNS0095608	Whole white alabastrum(tetraploid) 2	0.743
	CNS0095609	Whole white alabastrum(tetraploid) 3	1.337
	CNS0095610	Silvery flower (diploied) 1	0.531
	CNS0095611	Silvery flower (diploied) 2	1.014
	CNS0095612	Silvery flower (diploied) 3	0.639
	CNS0095613	Golden flower (tetraploid) 1	0.106
	CNS0095614	Golden flower (tetraploid) 2	0.992
	CNS0095615	Golden flower (tetraploid) 3	0.000
CRA001975	CRR073297	Stem 1	3.635
	CRR073298	Stem 2	3.166
	CRR073299	Stem 3	3.459
	CRR073300	Leaf 1	0.945
	CRR073301	Leaf 2	1.140
	CRR073302	Leaf 3	0.557
	CRR073303	Juvenile bud 1	0.314
	CRR073304	Juvenile bud 2	0.093
	CRR073305	Juvenile bud 3	0.000
	CRR073306	Third green 1	6.227
	CRR073307	Third green 2	1.810
	CRR073308	Third green 3	4.961
	CRR073309	Second white 1	0.067
	CRR073310	Second white 2	0.694
	CRR073311	Second white 3	0.629
	CRR073312	Silver flowering 1	0.000
	CRR073313	Silver flowering 2	0.000
	CRR073314	Silver flowering 3	0.000
	CRR073315	Gold flowering 1	0.000
	CRR073316	Gold flowering 2	0.000
	CRR073317	Gold flowering 3	0.000
	CRR073318	Tawny withering 1	1.761
	CRR073319	Tawny withering 2	1.559
	CRR073320	Tawny withering 3	4.452