Gene detail

Detail information of GWHGAAZE027748

Functional Annotation

Database	Orthologs	E value	Annotation
Nr	XP_004162335.1	2.0012E-55	PREDICTED: ethylene-responsive transcription factor ERF034-like [Cucumis sativus]
Swissprot	tr\|Q9SUK8\|ERF39_ARATH	6E-49	Ethylene-responsive transcription factor ERF039
trEMBL	tr\|A0A0A0L472\|A0A0A0L472_CUCSA	9E-55	Uncharacterized protein {ECO:0000313\|EMBL:KGN55849.1}
TAIR10	AT4G16750.1	7E-39	Integrase-type DNA-binding superfamily protein

Location And Transcript Sequence (JBrowse)

Scaffold	Type	Start	End	Strand
GWHAAZE00000008	gene	26891968	26892531	-
GWHAAZE00000008	mRNA	26891968	26892531	-
GWHAAZE00000008	exon	26892204	26892531	-
GWHAAZE00000008	exon	26891968	26892143	-
GWHAAZE00000008	CDS	26892204	26892531	-
GWHAAZE00000008	CDS	26891968	26892143	-

Transcript Sequence
>GWHTAAZE027782 ACCATTGAAGAGCAAAATGGTAAAAACAGAAATGACCAAAAACACCCCATTTACCGGGGCGTACGTAAACGGAGCTGGGGCAAATGGGTATCCGAAATCCGAGAGCCGAGAAAAAAGTCCCGAATATGGCTCGGAACATTCTCGACTCCCGAAATGGCGGCTCGAGCTCACGACGTAGCCGCCATCACTATCAAAGGCGGCTCGGCTCACCTCAATTTCCCAGAACTTGCTCATTTACTACCCCAGCCGGCTTCAAGCTCTCCCAAAGACATCCAAGCCGCGGCTTCTAAAGCCGCAGCCCTATCCGAAATTAATGCGAGCCGTGAAGGTTCATCGGGTTCGGGTGGGAGTAATGTTGATGACCCGTTTTATGATCTACCCGATTTGTTTATGGATTTAAGTGATCAGGTTGATGAGTTGTGTTTCTCTGTGCCGAGTCAACCCATCGGATATGAGTCCATCTACGGTGGGTTATGGCCGGAGGAGAATTTCTTGTGGGGTTAA

Network for GWHGAAZE027748

Network category	Network	Top300 PCC genelist
Coexpression Positive	Network	Top300 PCC genelist
Coexpression Negative	Network	Top300 PCC genelist

Functional Module

Module ID	Function Annotation

Protein Structure

Pfam accession	Pfam name	Alignment start	Alignment end	E-value
PF00847.21	AP2	16	66	5.00E-14

Protein Sequence

Gene family

Gene family	subfamily
Transcription Factors Family	AP2/ERF-ERF

KEGG pathway

KO	Enzyme	pathway	mapID
--	--	--	--

Gene Ontology

GO term	Ontology	Name
GO:0006355	biological_process	regulation of transcription, DNA-templated
GO:0003700	molecular_function	DNA-binding transcription factor activity
GO:0003677	molecular_function	DNA binding

Expression pattern

Expression pattern detail

SRP	Sample	Description	TPM
SRP075780	SRR3591705	youngest leaf	1.079
	SRR3591706	second leaf	3.264
	SRR3591707	mature leaf	5.233
	SRR3591708	Shoot apex	2.052
	SRR3591709	Stem	0.974
	SRR3591710	White floral bud	6.835
	SRR3591711	White flower	3.777
	SRR3591712	Green floral bud	3.990
	SRR3591713	Yellow flower	0.829
SRP173429	SRR8316895	Juvenile bud stage	3.618
	SRR8316896	Juvenile bud stage	6.793
	SRR8316897	Juvenile bud stage	1.271
	SRR8316894	Third green stage	0.949
	SRR8316900	Third green stage	2.303
	SRR8316901	Third green stage	3.694
	SRR8316898	Complete white stage	0.771
	SRR8316899	Complete white stage	0.907
	SRR8316903	Complete white stage	3.727
	SRR8316902	Silver flowering stage	0.395
	SRR8316904	Silver flowering stage	0.186
	SRR8316905	Silver flowering stage	0.245
	SRR8316906	Gold flowering stage	1.876
	SRR8316907	Gold flowering stage	2.339
	SRR8316908	Gold flowering stage	1.303
SRP132670	SRR6706286	Control	1.550
	SRR6706287	Light intensity 50%	1.905
	SRR6706288	Light intensity 20%	1.731
CNP0000432	CNS0095592	Slightly white alabastrum(diploid) 1	1.067
	CNS0095593	Slightly white alabastrum(diploid) 2	0.394
	CNS0095594	Slightly white alabastrum(diploid) 3	0.938
	CNS0095595	Whole white alabastrum(diploid) 2	2.561
	CNS0095596	Whole white alabastrum(diploid) 3	3.836
	CNS0095597	Whole white alabastrum(diploid) 4	2.429
	CNS0095598	Silvery flower (diploied) 1	0.976
	CNS0095599	Silvery flower (diploied) 2	1.862
	CNS0095600	Silvery flower (diploied) 3	1.062
	CNS0095601	Golden flower (diploid) 1	0.966
	CNS0095602	Golden flower (diploid) 2	1.500
	CNS0095603	Golden flower (diploid) 3	0.333
	CNS0095604	Slightly white alabastrum(tetraploid) 1	2.196
	CNS0095605	Slightly white alabastrum(tetraploid) 2	2.174
	CNS0095606	Slightly white alabastrum(tetraploid) 3	1.590
	CNS0095607	Whole white alabastrum(tetraploid) 1	3.593
	CNS0095608	Whole white alabastrum(tetraploid) 2	0.779
	CNS0095609	Whole white alabastrum(tetraploid) 3	1.353
	CNS0095610	Silvery flower (diploied) 1	1.499
	CNS0095611	Silvery flower (diploied) 2	0.899
	CNS0095612	Silvery flower (diploied) 3	2.712
	CNS0095613	Golden flower (tetraploid) 1	2.782
	CNS0095614	Golden flower (tetraploid) 2	0.796
	CNS0095615	Golden flower (tetraploid) 3	0.466
CRA001975	CRR073297	Stem 1	0.933
	CRR073298	Stem 2	1.558
	CRR073299	Stem 3	4.397
	CRR073300	Leaf 1	0.436
	CRR073301	Leaf 2	0.958
	CRR073302	Leaf 3	1.538
	CRR073303	Juvenile bud 1	0.715
	CRR073304	Juvenile bud 2	0.884
	CRR073305	Juvenile bud 3	1.102
	CRR073306	Third green 1	12.638
	CRR073307	Third green 2	8.576
	CRR073308	Third green 3	9.056
	CRR073309	Second white 1	3.801
	CRR073310	Second white 2	2.138
	CRR073311	Second white 3	0.739
	CRR073312	Silver flowering 1	0.275
	CRR073313	Silver flowering 2	0.054
	CRR073314	Silver flowering 3	0.206
	CRR073315	Gold flowering 1	2.766
	CRR073316	Gold flowering 2	0.343
	CRR073317	Gold flowering 3	4.588
	CRR073318	Tawny withering 1	6.091
	CRR073319	Tawny withering 2	8.365
	CRR073320	Tawny withering 3	2.262