Gene detail

Detail information of GWHGAAZE027949

Functional Annotation

Database	Orthologs	E value	Annotation
Nr	CAG28412.1	2.34677E-31	S-receptor kinase-like protein 1 [Senecio squalidus]
COG	YP_284821.1	0.0000002	protein kinase:GAF
Swissprot	tr\|Q9S972\|SD16_ARATH	7E-28	Receptor-like serine/threonine-protein kinase SD1-6 (Precursor)
trEMBL	tr\|Q5NJB1\|Q5NJB1_SENSQ	9E-32	S-receptor kinase-like protein 1 {ECO:0000313\|EMBL:CAG28412.1}
TAIR10	AT1G65800.1	5E-25	receptor kinase 2

Location And Transcript Sequence (JBrowse)

Scaffold	Type	Start	End	Strand
GWHAAZE00000008	gene	32311259	32312496	-
GWHAAZE00000008	mRNA	32311259	32312496	-
GWHAAZE00000008	exon	32311259	32311436	-
GWHAAZE00000008	exon	32312149	32312307	-
GWHAAZE00000008	exon	32312435	32312496	-
GWHAAZE00000008	CDS	32312435	32312496	-
GWHAAZE00000008	CDS	32312149	32312307	-
GWHAAZE00000008	CDS	32311259	32311436	-

Transcript Sequence
>GWHTAAZE027983 ATGGCGAGGATTTCCAAGCATAACGAAACAGAAGCAATGACTAAGAGGGTGGTTGGTACATACGGTTATTTGTCTCCTGAATATGCCATGGAAGGAAATTTCTCAGTGAAGTCTGATGTTTTTAGTTTTGGAGTTCTGATCCTGGAAATTGTGACTGGGAGGAGAAATGGCAGCTTTTATCATCATGAGCGTCTATTCAATCTCATAGGATATGTAAGTCGCCAGAAAAACTATATACACTTTCCTAGCGCGATGGTATCTGGGCATGTGTTGAATGACTGTTCTAGTGAGGCAACTAAGTTGCTCAGCGAAGTTGAGAATCGGGTTAATCTGAAGTCAAATAGGTCTCTTTTGGTGAGCGTTCTTTGCGCTTGTGCTACAGTGGGTGCATTTTTGTAA

Network for GWHGAAZE027949

Network category	Network	Top300 PCC genelist
Coexpression Positive	Network	Top300 PCC genelist
Coexpression Negative	Network	Top300 PCC genelist

Functional Module

Module ID	Function Annotation

Protein Structure

Pfam accession	Pfam name	Alignment start	Alignment end	E-value
PF07714.18	PK_Tyr_Ser-Thr	3	85	6.90E-09

Protein Sequence

Gene family

Gene family	subfamily
Protein Kinases Family	RLK-Pelle_DLSV

KEGG pathway

KO	Enzyme	pathway	mapID
--	--	--	--

Gene Ontology

GO term	Ontology	Name
GO:0006468	biological_process	protein phosphorylation
GO:0004672	molecular_function	protein kinase activity
GO:0005524	molecular_function	ATP binding

Expression pattern

Expression pattern detail

SRP	Sample	Description	TPM
SRP075780	SRR3591705	youngest leaf	0.000
	SRR3591706	second leaf	0.000
	SRR3591707	mature leaf	0.000
	SRR3591708	Shoot apex	0.000
	SRR3591709	Stem	0.000
	SRR3591710	White floral bud	0.219
	SRR3591711	White flower	0.187
	SRR3591712	Green floral bud	0.529
	SRR3591713	Yellow flower	0.000
SRP173429	SRR8316895	Juvenile bud stage	0.917
	SRR8316896	Juvenile bud stage	0.851
	SRR8316897	Juvenile bud stage	1.181
	SRR8316894	Third green stage	0.490
	SRR8316900	Third green stage	1.243
	SRR8316901	Third green stage	1.437
	SRR8316898	Complete white stage	0.031
	SRR8316899	Complete white stage	0.216
	SRR8316903	Complete white stage	0.171
	SRR8316902	Silver flowering stage	0.300
	SRR8316904	Silver flowering stage	0.319
	SRR8316905	Silver flowering stage	0.000
	SRR8316906	Gold flowering stage	0.022
	SRR8316907	Gold flowering stage	0.389
	SRR8316908	Gold flowering stage	0.475
SRP132670	SRR6706286	Control	0.668
	SRR6706287	Light intensity 50%	0.531
	SRR6706288	Light intensity 20%	0.748
CNP0000432	CNS0095592	Slightly white alabastrum(diploid) 1	0.011
	CNS0095593	Slightly white alabastrum(diploid) 2	0.160
	CNS0095594	Slightly white alabastrum(diploid) 3	0.006
	CNS0095595	Whole white alabastrum(diploid) 2	0.577
	CNS0095596	Whole white alabastrum(diploid) 3	0.179
	CNS0095597	Whole white alabastrum(diploid) 4	1.299
	CNS0095598	Silvery flower (diploied) 1	1.387
	CNS0095599	Silvery flower (diploied) 2	0.248
	CNS0095600	Silvery flower (diploied) 3	0.372
	CNS0095601	Golden flower (diploid) 1	1.205
	CNS0095602	Golden flower (diploid) 2	0.973
	CNS0095603	Golden flower (diploid) 3	0.303
	CNS0095604	Slightly white alabastrum(tetraploid) 1	1.091
	CNS0095605	Slightly white alabastrum(tetraploid) 2	0.426
	CNS0095606	Slightly white alabastrum(tetraploid) 3	0.474
	CNS0095607	Whole white alabastrum(tetraploid) 1	0.363
	CNS0095608	Whole white alabastrum(tetraploid) 2	0.000
	CNS0095609	Whole white alabastrum(tetraploid) 3	0.795
	CNS0095610	Silvery flower (diploied) 1	1.688
	CNS0095611	Silvery flower (diploied) 2	0.437
	CNS0095612	Silvery flower (diploied) 3	0.495
	CNS0095613	Golden flower (tetraploid) 1	0.542
	CNS0095614	Golden flower (tetraploid) 2	0.784
	CNS0095615	Golden flower (tetraploid) 3	0.020
CRA001975	CRR073297	Stem 1	1.053
	CRR073298	Stem 2	0.131
	CRR073299	Stem 3	0.000
	CRR073300	Leaf 1	1.546
	CRR073301	Leaf 2	1.342
	CRR073302	Leaf 3	0.370
	CRR073303	Juvenile bud 1	0.000
	CRR073304	Juvenile bud 2	0.000
	CRR073305	Juvenile bud 3	0.478
	CRR073306	Third green 1	0.000
	CRR073307	Third green 2	0.000
	CRR073308	Third green 3	0.000
	CRR073309	Second white 1	0.000
	CRR073310	Second white 2	0.000
	CRR073311	Second white 3	0.000
	CRR073312	Silver flowering 1	0.000
	CRR073313	Silver flowering 2	0.000
	CRR073314	Silver flowering 3	0.000
	CRR073315	Gold flowering 1	0.000
	CRR073316	Gold flowering 2	0.152
	CRR073317	Gold flowering 3	0.000
	CRR073318	Tawny withering 1	1.123
	CRR073319	Tawny withering 2	0.782
	CRR073320	Tawny withering 3	0.000