Gene detail

Detail information of GWHGAAZE028008

Functional Annotation

Database	Orthologs	E value	Annotation
Nr	KDO48367.1	7.8486E-135	hypothetical protein CISIN_1g015439mg [Citrus sinensis]
COG	YP_007216256.1	1E-32	Trehalose-6-phosphate phosphatase
Swissprot	tr\|Q9SUW0\|TPPG_ARATH	1E-119	Probable trehalose-phosphate phosphatase G
trEMBL	tr\|A0A067EAX2\|A0A067EAX2_CITSI	3E-135	Trehalose 6-phosphate phosphatase {ECO:0000256\|RuleBase:RU361117}
TAIR10	AT4G22590.1	3E-97	Haloacid dehalogenase-like hydrolase (HAD) superfamily protein

Location And Transcript Sequence (JBrowse)

Scaffold	Type	Start	End	Strand
GWHAAZE00000008	gene	33682275	33685372	-
GWHAAZE00000008	mRNA	33682275	33685372	-
GWHAAZE00000008	exon	33682275	33682397	-
GWHAAZE00000008	exon	33682797	33682898	-
GWHAAZE00000008	exon	33683085	33683141	-
GWHAAZE00000008	exon	33683352	33683477	-
GWHAAZE00000008	exon	33684173	33684244	-
GWHAAZE00000008	exon	33684364	33684504	-
GWHAAZE00000008	exon	33685178	33685372	-
GWHAAZE00000008	CDS	33685178	33685372	-
GWHAAZE00000008	CDS	33684364	33684504	-
GWHAAZE00000008	CDS	33684173	33684244	-
GWHAAZE00000008	CDS	33683352	33683477	-
GWHAAZE00000008	CDS	33683085	33683141	-
GWHAAZE00000008	CDS	33682797	33682898	-
GWHAAZE00000008	CDS	33682275	33682397	-

Transcript Sequence
>GWHTAAZE028042 ATGGACTTGAATCCGAGATTGTCTTCAAGTGGGGGATCGAATCCGAGGAAGAAACCTGGAAAGCTTGATGATATTCGTTCCGATGATTGCCTTGACGCTATGAAATCTTCATCTCCTCATGAAATGAAGGTGGTAAAAGATCATGGGGTCGAGGTTATTTCATCTGAAAATGATTTTGATTATCAATCTTGGATGGTCAAGTATCCATCGGCCCTTCAATGTTTCGAGAAAATCATGAATTATGCAAAGAAAAAGAAGGTAGTAATGTTTTTAGACTATGACGGGACTCTTTCTCCAATTGTAGATGATCCTGATCGCGCTTTCATGTCTGCTGATATGCGTTCCGCGGTTAAGAGTGTTGCAAAATATTTTCCAACCGCAATTATTAGTGGAAGAAGTCGCGATAAGGTTTATGAATTGGTAGGACTAACAGAATTATATTACGCGGGTAGCCATGGAATGGACATTATGTTCCCGGTTAGAGAGACTGTGTCCACTGACCATTCAAATTGTATTAAATCTACAAATTCACAGGGCGAGGAAGTAAATCTTTTCCAGCCTGCTAGAGAATTTTTACCGATGATTGATGAGGTTTTTAGAAGCCTTGTCGAGAATACTAAGAATATAAATGGTGCAAAAGTAGAGAACCACAGATTTTGTGCCTCTGTACATTATCGAAATGTAGATGAGAAGAGTTGGCCTATGGTTGCGCAATGTGTTCGTGATACCTTGAAAGATTACCCTCGGTTACGACTAACTCATGGGAGGAAGGTATTTTATTTACTATACTATATTAAATTATTTTTGTACACATAA

Network for GWHGAAZE028008

Network category	Network	Top300 PCC genelist
Coexpression Positive	Network	Top300 PCC genelist
Coexpression Negative	Network	Top300 PCC genelist

Functional Module

Module ID	Function Annotation

Protein Structure

Pfam accession	Pfam name	Alignment start	Alignment end	E-value
PF02358.17	Trehalose_PPase	90	259	4.60E-46

Protein Sequence

Gene family

Gene family	subfamily
--	--

KEGG pathway

KO	Enzyme	pathway	mapID
K01087	otsB	Metabolic pathways	map01100
		Biosynthesis of secondary metabolites	map01110
		Starch and sucrose metabolism	map00500

Gene Ontology

GO term	Ontology	Name
GO:0005992	biological_process	trehalose biosynthetic process
GO:0003824	molecular_function	catalytic activity

Expression pattern

Expression pattern detail

SRP	Sample	Description	TPM
SRP075780	SRR3591705	youngest leaf	0.286
	SRR3591706	second leaf	1.412
	SRR3591707	mature leaf	0.350
	SRR3591708	Shoot apex	2.446
	SRR3591709	Stem	0.017
	SRR3591710	White floral bud	28.135
	SRR3591711	White flower	2.673
	SRR3591712	Green floral bud	13.421
	SRR3591713	Yellow flower	0.611
SRP173429	SRR8316895	Juvenile bud stage	0.581
	SRR8316896	Juvenile bud stage	0.941
	SRR8316897	Juvenile bud stage	2.641
	SRR8316894	Third green stage	1.575
	SRR8316900	Third green stage	17.893
	SRR8316901	Third green stage	18.064
	SRR8316898	Complete white stage	0.000
	SRR8316899	Complete white stage	0.608
	SRR8316903	Complete white stage	0.126
	SRR8316902	Silver flowering stage	0.000
	SRR8316904	Silver flowering stage	0.406
	SRR8316905	Silver flowering stage	0.005
	SRR8316906	Gold flowering stage	0.032
	SRR8316907	Gold flowering stage	0.164
	SRR8316908	Gold flowering stage	0.000
SRP132670	SRR6706286	Control	4.351
	SRR6706287	Light intensity 50%	4.335
	SRR6706288	Light intensity 20%	3.286
CNP0000432	CNS0095592	Slightly white alabastrum(diploid) 1	12.490
	CNS0095593	Slightly white alabastrum(diploid) 2	14.658
	CNS0095594	Slightly white alabastrum(diploid) 3	10.216
	CNS0095595	Whole white alabastrum(diploid) 2	34.055
	CNS0095596	Whole white alabastrum(diploid) 3	37.824
	CNS0095597	Whole white alabastrum(diploid) 4	36.194
	CNS0095598	Silvery flower (diploied) 1	0.632
	CNS0095599	Silvery flower (diploied) 2	1.402
	CNS0095600	Silvery flower (diploied) 3	0.377
	CNS0095601	Golden flower (diploid) 1	0.630
	CNS0095602	Golden flower (diploid) 2	0.222
	CNS0095603	Golden flower (diploid) 3	0.290
	CNS0095604	Slightly white alabastrum(tetraploid) 1	21.803
	CNS0095605	Slightly white alabastrum(tetraploid) 2	22.761
	CNS0095606	Slightly white alabastrum(tetraploid) 3	0.361
	CNS0095607	Whole white alabastrum(tetraploid) 1	35.045
	CNS0095608	Whole white alabastrum(tetraploid) 2	43.677
	CNS0095609	Whole white alabastrum(tetraploid) 3	21.783
	CNS0095610	Silvery flower (diploied) 1	0.369
	CNS0095611	Silvery flower (diploied) 2	0.683
	CNS0095612	Silvery flower (diploied) 3	2.301
	CNS0095613	Golden flower (tetraploid) 1	0.377
	CNS0095614	Golden flower (tetraploid) 2	0.309
	CNS0095615	Golden flower (tetraploid) 3	1.025
CRA001975	CRR073297	Stem 1	0.312
	CRR073298	Stem 2	0.275
	CRR073299	Stem 3	0.000
	CRR073300	Leaf 1	4.935
	CRR073301	Leaf 2	2.520
	CRR073302	Leaf 3	1.445
	CRR073303	Juvenile bud 1	2.829
	CRR073304	Juvenile bud 2	1.049
	CRR073305	Juvenile bud 3	0.206
	CRR073306	Third green 1	0.295
	CRR073307	Third green 2	0.512
	CRR073308	Third green 3	0.436
	CRR073309	Second white 1	0.055
	CRR073310	Second white 2	0.048
	CRR073311	Second white 3	0.107
	CRR073312	Silver flowering 1	0.700
	CRR073313	Silver flowering 2	0.414
	CRR073314	Silver flowering 3	0.408
	CRR073315	Gold flowering 1	1.851
	CRR073316	Gold flowering 2	0.242
	CRR073317	Gold flowering 3	0.162
	CRR073318	Tawny withering 1	1.142
	CRR073319	Tawny withering 2	1.377
	CRR073320	Tawny withering 3	0.366